Mutagenetix > Incidental Mutation

Incidental Mutation 'R2014:Kif21b'

222492

Institutional Source

Beutler Lab

Gene Symbol

Kif21b

Ensembl Gene

ENSMUSG00000041642

Gene Name

kinesin family member 21B

Synonyms

N-5 kinesin, 2610511N21Rik

MMRRC Submission

040023-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.177) question?

Stock #

R2014 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136131389-136177998 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 136148282 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 270 (F270L)

Ref Sequence

ENSEMBL: ENSMUSP00000114297 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000075164
AA Change: F270L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: F270L

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	3.81e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122892

Predicted Effect

probably damaging
Transcript: ENSMUST00000130864
AA Change: F270L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: F270L

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	5.1e-6	SMART

Meta Mutation Damage Score

0.5361

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

96% (105/109)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	T	A	5: 5,455,964	I106L	probably benign	Het
1700122O11Rik	T	G	17: 48,036,914	T194P	possibly damaging	Het
Acsbg2	T	A	17: 56,853,855	K263M	possibly damaging	Het
Adcy8	C	T	15: 64,767,878	G678S	probably benign	Het
Adgrl2	C	T	3: 148,826,475	G1041R	probably damaging	Het
Ahnak	T	C	19: 9,013,181	I3943T	probably damaging	Het
Aire	T	C	10: 78,042,958	D85G	probably damaging	Het
Alkbh8	C	T	9: 3,343,216	Q36*	probably null	Het
Amer3	T	C	1: 34,579,444		probably benign	Het
Angptl8	T	C	9: 21,837,062		probably null	Het
Ankmy1	T	C	1: 92,885,141	D482G	probably benign	Het
Apc	A	G	18: 34,315,591	I1813V	probably damaging	Het
Asb13	T	G	13: 3,649,512		probably null	Het
Blm	T	C	7: 80,502,399	E600G	probably damaging	Het
Cd163	G	T	6: 124,325,498	W1007L	probably damaging	Het
Cdr1	A	G	X: 61,184,814	F249L	probably benign	Het
Cp	A	G	3: 19,987,434	K44E	probably benign	Het
Crtap	C	A	9: 114,381,585		probably null	Het
Ctsk	A	G	3: 95,506,692	D250G	probably damaging	Het
Dcp2	T	C	18: 44,410,296	V307A	probably benign	Het
Dnah6	T	A	6: 73,173,419	D787V	probably damaging	Het
Dtx3l	G	A	16: 35,936,427	H129Y	probably benign	Het
Ece2	A	G	16: 20,642,317	T442A	probably benign	Het
Espl1	C	T	15: 102,322,714	R17*	probably null	Het
Espn	G	T	4: 152,132,959		probably null	Het
Fam20b	C	T	1: 156,705,941	R35Q	possibly damaging	Het
Fga	A	G	3: 83,032,757	I573V	probably damaging	Het
Fmo5	A	G	3: 97,635,682	K103E	possibly damaging	Het
Frem1	A	T	4: 83,005,852	V291D	probably damaging	Het
Gabbr1	A	G	17: 37,056,782		probably null	Het
Gjb6	T	C	14: 57,124,756	H16R	probably damaging	Het
Gm438	A	T	4: 144,779,725	L132Q	probably damaging	Het
Grina	T	C	15: 76,248,534	V167A	probably damaging	Het
Gulo	T	A	14: 66,009,047	M1L	probably benign	Het
Hcfc2	A	G	10: 82,738,980	N618D	probably benign	Het
Heatr5b	T	C	17: 78,814,184	D704G	probably damaging	Het
Hlcs	A	G	16: 94,262,740	V487A	probably benign	Het
Hps1	G	A	19: 42,762,512	P350S	probably benign	Het
Hspa9	A	T	18: 34,946,648	Y243N	probably damaging	Het
Igll1	A	G	16: 16,863,775	S39P	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt27	A	G	11: 99,349,492	V200A	probably benign	Het
Lama3	T	C	18: 12,524,721		probably benign	Het
Lmcd1	T	C	6: 112,328,741	W268R	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Mamdc4	T	A	2: 25,563,572	D1195V	probably damaging	Het
Map2	T	C	1: 66,416,136	V1395A	possibly damaging	Het
Map3k20	C	T	2: 72,438,260	T537M	probably benign	Het
Mdga1	A	G	17: 29,849,313	S276P	probably damaging	Het
Mep1a	T	C	17: 43,497,906	N85D	probably benign	Het
Mettl16	A	G	11: 74,817,369	S425G	probably benign	Het
Mthfd1l	A	G	10: 4,047,894	T622A	probably benign	Het
Nbeal2	G	A	9: 110,634,071	L1309F	probably benign	Het
Nde1	A	T	16: 14,169,457		probably benign	Het
Nhsl1	A	T	10: 18,511,592	R205W	probably damaging	Het
Nlrc5	A	G	8: 94,525,510		probably benign	Het
Notch3	C	A	17: 32,158,000	E310D	probably benign	Het
Olfr1180	T	C	2: 88,412,044	T205A	probably benign	Het
Olfr1355	T	C	10: 78,879,388	I72T	possibly damaging	Het
Olfr453	A	G	6: 42,744,850	E271G	probably damaging	Het
Olfr994	T	A	2: 85,430,352	H159L	possibly damaging	Het
Osbpl5	C	A	7: 143,741,692	C11F	probably damaging	Het
P4hb	T	C	11: 120,562,696	E381G	probably damaging	Het
Pax4	A	G	6: 28,446,210	Y95H	probably benign	Het
Pdia3	T	C	2: 121,434,820	V390A	probably damaging	Het
Pigv	A	C	4: 133,662,723	D49E	possibly damaging	Het
Pik3c2a	T	A	7: 116,350,931		probably null	Het
Plxnb1	T	A	9: 109,106,619		probably benign	Het
Polq	A	G	16: 37,078,366	T2163A	probably damaging	Het
Pou5f2	T	C	13: 78,025,853	S305P	probably benign	Het
Ppm1h	A	T	10: 122,920,725	H425L	possibly damaging	Het
Ppp1r13b	G	T	12: 111,833,788	D518E	probably benign	Het
Prf1	A	T	10: 61,303,895	D544V	probably benign	Het
Prl3b1	T	C	13: 27,247,965	F158L	probably benign	Het
Prss41	C	T	17: 23,837,490		probably null	Het
Prune2	T	G	19: 17,120,523	N1130K	probably damaging	Het
Ptgdr2	T	C	19: 10,940,425	F102S	probably damaging	Het
Ptprq	T	G	10: 107,667,422	K792Q	probably damaging	Het
Rcbtb2	T	C	14: 73,174,386		probably benign	Het
Rgs14	C	A	13: 55,383,700	S479*	probably null	Het
Sash1	A	T	10: 8,729,413	V1071D	probably benign	Het
Sdsl	G	A	5: 120,463,153	T18M	probably damaging	Het
Sepsecs	T	A	5: 52,647,624	Q365L	probably benign	Het
Sh2d4a	A	T	8: 68,331,083	Q223L	probably damaging	Het
Slc14a2	T	C	18: 78,150,386		probably benign	Het
Slc5a9	A	C	4: 111,896,349	S52A	possibly damaging	Het
Slc6a18	C	A	13: 73,675,725	V99L	probably benign	Het
Smarca2	T	C	19: 26,683,905	S967P	possibly damaging	Het
Tbc1d22a	C	T	15: 86,299,684	T248M	probably damaging	Het
Tcte1	A	T	17: 45,541,311	N490I	probably benign	Het
Tet3	T	C	6: 83,386,075	E705G	probably damaging	Het
Tfeb	T	A	17: 47,791,559	H450Q	probably damaging	Het
Tmem248	G	A	5: 130,231,812	E73K	probably damaging	Het
Trip12	A	T	1: 84,760,866	L756*	probably null	Het
Try5	C	T	6: 41,314,651		probably null	Het
Tsc1	A	T	2: 28,665,637		probably benign	Het
Tspear	G	A	10: 77,875,120		probably benign	Het
Ttc6	T	C	12: 57,576,217	I134T	possibly damaging	Het
Ttn	T	A	2: 76,755,296		probably null	Het
Ube3b	A	G	5: 114,411,149	E738G	probably damaging	Het
Usp36	T	C	11: 118,262,508		probably benign	Het
Vmn2r71	T	A	7: 85,620,637	M452K	probably benign	Het
Vps13b	T	C	15: 35,607,142	S1074P	probably damaging	Het
Vps13d	A	G	4: 145,108,508	S2757P	probably damaging	Het
Vwde	C	A	6: 13,208,338	G182C	possibly damaging	Het
Wdr33	T	C	18: 31,833,599	V164A	probably damaging	Het
Zkscan16	A	G	4: 58,956,525	Y269C	possibly damaging	Het
Zufsp	A	G	10: 33,929,824	V437A	possibly damaging	Het

Other mutations in Kif21b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Kif21b	APN	1	136152342	missense	possibly damaging	0.68
IGL01020:Kif21b	APN	1	136154094	splice site	probably benign
IGL01288:Kif21b	APN	1	136172184	missense	probably benign	0.00
IGL02105:Kif21b	APN	1	136171303	missense	probably benign
IGL02264:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02303:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02308:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02310:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02419:Kif21b	APN	1	136151267	missense	probably benign	0.00
IGL02553:Kif21b	APN	1	136154121	missense	probably damaging	1.00
IGL02568:Kif21b	APN	1	136172867	missense	probably damaging	0.96
IGL02657:Kif21b	APN	1	136172230	missense	possibly damaging	0.88
IGL03068:Kif21b	APN	1	136158355	unclassified	probably benign
IGL03230:Kif21b	APN	1	136162812	missense	probably benign	0.03
R0629_Kif21b_729	UTSW	1	136172157	critical splice acceptor site	probably null
Schiessen	UTSW	1	136147869	critical splice donor site	probably null
wolfen	UTSW	1	136144758	nonsense	probably null
R0190:Kif21b	UTSW	1	136171219	missense	probably benign	0.32
R0349:Kif21b	UTSW	1	136149311	missense	probably damaging	0.97
R0501:Kif21b	UTSW	1	136163099	missense	probably benign	0.44
R0620:Kif21b	UTSW	1	136159428	missense	possibly damaging	0.88
R0629:Kif21b	UTSW	1	136172157	critical splice acceptor site	probably null
R0741:Kif21b	UTSW	1	136159744	missense	probably damaging	1.00
R1087:Kif21b	UTSW	1	136162823	missense	probably damaging	1.00
R1217:Kif21b	UTSW	1	136152376	missense	probably damaging	1.00
R1464:Kif21b	UTSW	1	136156153	missense	possibly damaging	0.50
R1464:Kif21b	UTSW	1	136156153	missense	possibly damaging	0.50
R1511:Kif21b	UTSW	1	136169324	critical splice donor site	probably null
R1512:Kif21b	UTSW	1	136152805	missense	probably benign	0.01
R1513:Kif21b	UTSW	1	136156111	missense	probably damaging	0.98
R1591:Kif21b	UTSW	1	136149317	missense	probably damaging	1.00
R1616:Kif21b	UTSW	1	136171685	missense	probably damaging	1.00
R1628:Kif21b	UTSW	1	136171220	missense	probably benign	0.01
R1658:Kif21b	UTSW	1	136171285	missense	probably damaging	1.00
R1728:Kif21b	UTSW	1	136160121	missense	possibly damaging	0.85
R1741:Kif21b	UTSW	1	136156142	missense	probably damaging	1.00
R1784:Kif21b	UTSW	1	136160121	missense	possibly damaging	0.85
R1807:Kif21b	UTSW	1	136147793	missense	possibly damaging	0.94
R1896:Kif21b	UTSW	1	136147845	missense	possibly damaging	0.90
R1970:Kif21b	UTSW	1	136171156	missense	probably damaging	1.00
R1984:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1985:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1986:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1988:Kif21b	UTSW	1	136152264	missense	probably damaging	0.98
R1990:Kif21b	UTSW	1	136161770	missense	probably damaging	1.00
R2045:Kif21b	UTSW	1	136160313	missense	probably damaging	1.00
R2141:Kif21b	UTSW	1	136152264	missense	probably damaging	0.98
R2248:Kif21b	UTSW	1	136172966	missense	probably damaging	1.00
R2886:Kif21b	UTSW	1	136147874	splice site	probably benign
R2896:Kif21b	UTSW	1	136154217	missense	possibly damaging	0.82
R3706:Kif21b	UTSW	1	136159410	missense	probably benign	0.06
R3780:Kif21b	UTSW	1	136156226	missense	probably damaging	0.99
R3827:Kif21b	UTSW	1	136162994	critical splice donor site	probably null
R4227:Kif21b	UTSW	1	136154093	splice site	probably null
R4600:Kif21b	UTSW	1	136147864	missense	probably benign	0.39
R4608:Kif21b	UTSW	1	136148186	intron	probably benign
R4749:Kif21b	UTSW	1	136144749	nonsense	probably null
R4841:Kif21b	UTSW	1	136145220	missense	probably damaging	1.00
R4842:Kif21b	UTSW	1	136145220	missense	probably damaging	1.00
R4933:Kif21b	UTSW	1	136151325	splice site	probably null
R4959:Kif21b	UTSW	1	136148370	missense	possibly damaging	0.90
R5018:Kif21b	UTSW	1	136172234	missense	probably benign	0.30
R5116:Kif21b	UTSW	1	136152783	missense	probably damaging	0.99
R5119:Kif21b	UTSW	1	136163100	missense	probably benign
R5197:Kif21b	UTSW	1	136144625	missense	probably damaging	1.00
R5230:Kif21b	UTSW	1	136171673	missense	probably damaging	1.00
R5249:Kif21b	UTSW	1	136169228	missense	probably damaging	1.00
R5337:Kif21b	UTSW	1	136171143	missense	probably damaging	1.00
R5358:Kif21b	UTSW	1	136172292	missense	possibly damaging	0.85
R5466:Kif21b	UTSW	1	136147525	missense	probably damaging	1.00
R5557:Kif21b	UTSW	1	136170059	missense	probably damaging	1.00
R5727:Kif21b	UTSW	1	136170009	missense	probably damaging	1.00
R5865:Kif21b	UTSW	1	136151137	nonsense	probably null
R5929:Kif21b	UTSW	1	136151207	missense	probably damaging	1.00
R6274:Kif21b	UTSW	1	136149418	missense	possibly damaging	0.57
R6349:Kif21b	UTSW	1	136158326	missense	probably damaging	1.00
R6648:Kif21b	UTSW	1	136152397	missense	probably benign	0.00
R6831:Kif21b	UTSW	1	136144758	nonsense	probably null
R7156:Kif21b	UTSW	1	136147824	missense	probably damaging	1.00
R7165:Kif21b	UTSW	1	136149448	missense	probably damaging	0.98
R7327:Kif21b	UTSW	1	136159649	missense	possibly damaging	0.60
R7680:Kif21b	UTSW	1	136147869	critical splice donor site	probably null
R7975:Kif21b	UTSW	1	136171173	missense	probably damaging	1.00
R8356:Kif21b	UTSW	1	136172945	missense	probably damaging	1.00
R8467:Kif21b	UTSW	1	136172283	missense	probably damaging	0.98
R9031:Kif21b	UTSW	1	136145304	missense	probably damaging	0.99
R9101:Kif21b	UTSW	1	136151155	missense	probably damaging	0.96
R9191:Kif21b	UTSW	1	136172821	nonsense	probably null
R9261:Kif21b	UTSW	1	136149424	missense	probably damaging	1.00
R9280:Kif21b	UTSW	1	136171707	critical splice donor site	probably null
R9307:Kif21b	UTSW	1	136174062	missense	probably benign
R9562:Kif21b	UTSW	1	136149352	missense	probably damaging	0.99
R9563:Kif21b	UTSW	1	136149428	missense	probably damaging	1.00
R9565:Kif21b	UTSW	1	136149352	missense	probably damaging	0.99
R9758:Kif21b	UTSW	1	136153223	missense	probably damaging	1.00
R9760:Kif21b	UTSW	1	136148683	missense	probably damaging	1.00
RF024:Kif21b	UTSW	1	136158341	missense	probably damaging	1.00
X0053:Kif21b	UTSW	1	136149316	missense	probably damaging	1.00
X0066:Kif21b	UTSW	1	136172945	missense	probably damaging	1.00
Z1176:Kif21b	UTSW	1	136154137	missense	probably benign	0.00
Z1177:Kif21b	UTSW	1	136148312	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCACTCTCATGGATGGTGG -3'
(R):5'- AGCTAACAGGGTCCTTTGGG -3'

Sequencing Primer
(F):5'- CTCACTCTCATGGATGGTGGTACTG -3'
(R):5'- TGTTCCAGTCAGCAGCTAGAAGC -3'

Posted On

2014-08-25