Incidental Mutation 'R2007:Dchs1'
ID 222497
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Name dachsous cadherin related 1
Synonyms 3110041P15Rik, C130033F22Rik
MMRRC Submission 040016-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2007 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 105752990-105787654 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105755325 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 2670 (V2670E)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033184] [ENSMUST00000078482] [ENSMUST00000210066]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000033184
SMART Domains Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pro-kuma_activ 32 176 4.53e-50 SMART
low complexity region 177 189 N/A INTRINSIC
Pfam:Peptidase_S8 251 492 1.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078482
AA Change: V2670E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: V2670E

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140959
Predicted Effect probably benign
Transcript: ENSMUST00000210066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211659
Meta Mutation Damage Score 0.9735 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,542,892 N1387K probably benign Het
Abca13 T C 11: 9,191,987 F8L probably benign Het
Abcg5 G T 17: 84,669,920 L270M probably damaging Het
Acad10 A G 5: 121,634,751 L489S probably damaging Het
Acsf2 G A 11: 94,571,640 T183I possibly damaging Het
Adamts7 A T 9: 90,177,856 E282V probably damaging Het
Adcy4 C T 14: 55,778,313 G440R possibly damaging Het
AI429214 G A 8: 36,993,769 V24I probably benign Het
Angptl3 T C 4: 99,037,397 I320T probably damaging Het
Apoa5 A T 9: 46,270,367 Q247L possibly damaging Het
Astn1 T G 1: 158,609,305 V811G probably damaging Het
Bard1 C T 1: 71,031,403 V641I probably benign Het
Calb2 T C 8: 110,168,070 E23G probably benign Het
Cdkl4 A G 17: 80,556,301 probably benign Het
Cep85l A G 10: 53,278,075 probably benign Het
Chd1 G T 17: 15,731,006 G281V probably damaging Het
Col17a1 C T 19: 47,667,702 G586E probably damaging Het
Cpne3 T A 4: 19,553,833 D66V probably damaging Het
Csde1 A T 3: 103,044,791 I204L probably damaging Het
Ddx10 A G 9: 53,213,278 V428A probably benign Het
Dgkh T A 14: 78,603,049 D530V probably benign Het
Dis3l A T 9: 64,308,276 probably null Het
Dst T G 1: 34,226,012 probably benign Het
Eml6 C T 11: 29,848,814 probably null Het
En1 A T 1: 120,603,404 E124D probably benign Het
Exo1 G A 1: 175,908,530 E827K probably damaging Het
Fktn T C 4: 53,735,099 F246L possibly damaging Het
Fndc1 G A 17: 7,778,748 probably benign Het
Foxp2 G A 6: 15,396,819 C381Y probably damaging Het
Galnt6 A T 15: 100,697,166 Y485N probably damaging Het
Gemin4 G A 11: 76,212,618 A439V possibly damaging Het
Gpatch8 A G 11: 102,500,831 I155T unknown Het
Hmcn2 A G 2: 31,438,255 D4316G possibly damaging Het
Hnrnpr T A 4: 136,319,513 probably benign Het
Hpx G A 7: 105,595,574 R135C probably damaging Het
Khdrbs2 T G 1: 32,520,548 E151A probably benign Het
Krt6b A T 15: 101,678,127 L309H probably damaging Het
Lce1c G T 3: 92,680,458 C64F unknown Het
Maats1 T C 16: 38,298,254 I728V probably benign Het
March6 C T 15: 31,461,941 probably null Het
Myt1 C A 2: 181,795,759 R88S probably benign Het
Nemp1 A G 10: 127,693,577 S194G probably benign Het
Nphp4 A G 4: 152,554,654 K914R probably damaging Het
Olfr410 T A 11: 74,334,386 T282S possibly damaging Het
Osbp T C 19: 11,973,901 M270T probably benign Het
Parg T C 14: 32,210,574 M457T possibly damaging Het
Phf20 T C 2: 156,287,954 M482T probably benign Het
Pik3c2a G A 7: 116,342,237 T1598I probably damaging Het
Pkd1 T C 17: 24,579,785 M2689T probably damaging Het
Plxnd1 A T 6: 115,967,255 V1091E probably damaging Het
Ptcd2 A T 13: 99,320,236 L360Q probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Serpinc1 A T 1: 160,993,540 T65S probably benign Het
Sipa1l2 G A 8: 125,439,437 T1486I probably damaging Het
Snrnp200 T C 2: 127,227,048 L949P probably damaging Het
Ssc5d T G 7: 4,928,629 C278W probably damaging Het
Tbc1d14 T G 5: 36,571,374 H216P possibly damaging Het
Tmem183a A G 1: 134,350,123 F301S probably damaging Het
Tmem233 A C 5: 116,051,437 N94K possibly damaging Het
Tmprss13 A G 9: 45,332,545 D193G probably damaging Het
Tprkb T C 6: 85,933,048 probably benign Het
Tram1l1 A G 3: 124,321,839 H216R possibly damaging Het
Ttn A G 2: 76,734,140 V28551A probably damaging Het
Ubtfl1 A G 9: 18,409,251 N25S possibly damaging Het
Unc80 C A 1: 66,503,776 N396K probably damaging Het
Vmn1r171 T C 7: 23,632,587 L79P probably damaging Het
Vmn2r115 G T 17: 23,347,953 V480F possibly damaging Het
Xpo4 T C 14: 57,586,644 I995V probably null Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105758743 missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105758029 missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105758424 missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105755261 missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105758207 missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105757943 missense probably benign
IGL01292:Dchs1 APN 7 105760891 missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105762211 missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105772283 missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105771927 missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105755302 missense probably benign 0.00
IGL01829:Dchs1 APN 7 105755397 missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105759105 missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105757591 missense probably benign 0.00
IGL02012:Dchs1 APN 7 105764297 missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105764887 missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105772569 missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105755188 missense probably benign 0.22
IGL02430:Dchs1 APN 7 105771971 missense probably benign 0.34
IGL02500:Dchs1 APN 7 105755806 missense probably benign
IGL02741:Dchs1 APN 7 105757323 missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105756491 missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105755072 missense probably damaging 1.00
G1patch:Dchs1 UTSW 7 105758793 missense probably damaging 0.99
P0026:Dchs1 UTSW 7 105758405 missense probably damaging 0.99
PIT4377001:Dchs1 UTSW 7 105757588 missense probably damaging 1.00
PIT4791001:Dchs1 UTSW 7 105758971 missense probably damaging 1.00
R0013:Dchs1 UTSW 7 105755836 missense possibly damaging 0.90
R0090:Dchs1 UTSW 7 105755932 missense probably benign 0.18
R0091:Dchs1 UTSW 7 105766094 splice site probably benign
R0193:Dchs1 UTSW 7 105764983 missense probably benign 0.40
R0395:Dchs1 UTSW 7 105758538 missense probably damaging 1.00
R0448:Dchs1 UTSW 7 105765927 missense probably benign 0.00
R0480:Dchs1 UTSW 7 105771489 missense probably benign 0.14
R0485:Dchs1 UTSW 7 105772727 missense probably benign 0.00
R0566:Dchs1 UTSW 7 105759195 missense probably benign 0.00
R0571:Dchs1 UTSW 7 105771996 missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105758778 missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105764255 missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105763449 missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105772349 missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105764984 missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105757714 missense probably benign
R1241:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105755571 missense probably benign 0.40
R1427:Dchs1 UTSW 7 105766191 missense probably benign 0.06
R1458:Dchs1 UTSW 7 105755244 missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105772071 nonsense probably null
R1524:Dchs1 UTSW 7 105764525 missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105758931 missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105772040 missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105771861 missense probably benign 0.01
R1577:Dchs1 UTSW 7 105765955 missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105762770 missense probably benign 0.24
R1676:Dchs1 UTSW 7 105754921 missense probably benign 0.40
R1794:Dchs1 UTSW 7 105771720 missense probably benign 0.02
R1826:Dchs1 UTSW 7 105757627 missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105764156 missense probably benign 0.00
R1924:Dchs1 UTSW 7 105772280 missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105765902 missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105764201 missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105772398 missense possibly damaging 0.72
R1993:Dchs1 UTSW 7 105762548 missense probably benign 0.00
R2316:Dchs1 UTSW 7 105764204 missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105754094 missense probably benign
R2474:Dchs1 UTSW 7 105755074 missense probably benign 0.37
R2474:Dchs1 UTSW 7 105772838 missense probably damaging 1.00
R3429:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105762316 missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105757085 missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105761635 missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105762563 missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105765140 missense probably damaging 1.00
R4209:Dchs1 UTSW 7 105766190 missense probably damaging 0.99
R4329:Dchs1 UTSW 7 105753759 missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105754852 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105754765 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105758973 missense probably benign
R4588:Dchs1 UTSW 7 105756041 missense probably benign
R4613:Dchs1 UTSW 7 105772724 missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105754355 missense probably benign 0.02
R4696:Dchs1 UTSW 7 105764627 missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4725:Dchs1 UTSW 7 105765552 missense probably damaging 1.00
R4738:Dchs1 UTSW 7 105758673 missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105771620 missense possibly damaging 0.96
R4784:Dchs1 UTSW 7 105765926 missense probably damaging 1.00
R4864:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4880:Dchs1 UTSW 7 105755730 missense probably benign 0.00
R4909:Dchs1 UTSW 7 105766255 missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105772177 missense probably benign 0.09
R5109:Dchs1 UTSW 7 105765014 missense probably benign
R5126:Dchs1 UTSW 7 105753517 missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105755658 missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105754602 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105772055 missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105755293 missense probably benign 0.11
R5623:Dchs1 UTSW 7 105772769 missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105772809 missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105755748 missense probably benign 0.01
R5743:Dchs1 UTSW 7 105771596 missense probably benign
R5759:Dchs1 UTSW 7 105764176 missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105773040 missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105772035 missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105759166 missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105755925 missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105754095 missense probably benign 0.08
R6065:Dchs1 UTSW 7 105755421 missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105760925 missense probably benign
R6137:Dchs1 UTSW 7 105765106 missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105764938 missense probably benign 0.05
R6363:Dchs1 UTSW 7 105758472 missense probably benign 0.12
R6466:Dchs1 UTSW 7 105764541 missense probably benign 0.09
R6544:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105758806 missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105762913 missense probably benign 0.17
R6632:Dchs1 UTSW 7 105761878 missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105758793 missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105757003 missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105763503 missense possibly damaging 0.91
R7058:Dchs1 UTSW 7 105757021 missense probably benign
R7064:Dchs1 UTSW 7 105763185 missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105761871 missense probably benign 0.04
R7191:Dchs1 UTSW 7 105765439 missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105755131 nonsense probably null
R7380:Dchs1 UTSW 7 105758628 missense probably benign 0.35
R7438:Dchs1 UTSW 7 105754948 missense probably benign 0.30
R7496:Dchs1 UTSW 7 105761859 missense probably damaging 1.00
R7534:Dchs1 UTSW 7 105772373 missense probably benign 0.00
R7604:Dchs1 UTSW 7 105765982 missense probably damaging 1.00
R7631:Dchs1 UTSW 7 105759238 missense probably benign
R7821:Dchs1 UTSW 7 105765145 missense probably benign 0.00
R7834:Dchs1 UTSW 7 105765567 missense probably benign 0.39
R7841:Dchs1 UTSW 7 105762973 missense probably benign
R7913:Dchs1 UTSW 7 105759228 missense possibly damaging 0.61
R8041:Dchs1 UTSW 7 105755188 missense probably benign 0.45
R8076:Dchs1 UTSW 7 105755921 missense possibly damaging 0.52
R8076:Dchs1 UTSW 7 105761982 missense probably damaging 1.00
R8087:Dchs1 UTSW 7 105753499 missense probably benign 0.41
R8125:Dchs1 UTSW 7 105764882 missense possibly damaging 0.91
R8223:Dchs1 UTSW 7 105762617 missense possibly damaging 0.81
R8239:Dchs1 UTSW 7 105765511 missense probably benign 0.22
R8476:Dchs1 UTSW 7 105758808 missense probably benign 0.05
R8497:Dchs1 UTSW 7 105758961 missense probably damaging 1.00
R8770:Dchs1 UTSW 7 105771738 missense probably damaging 1.00
R8856:Dchs1 UTSW 7 105760857 missense probably damaging 1.00
R8866:Dchs1 UTSW 7 105755390 missense probably benign 0.00
R8948:Dchs1 UTSW 7 105759005 missense probably benign 0.30
R8950:Dchs1 UTSW 7 105759005 missense probably benign 0.30
R9029:Dchs1 UTSW 7 105753712 missense probably benign 0.13
R9039:Dchs1 UTSW 7 105756008 missense probably benign 0.11
R9081:Dchs1 UTSW 7 105754429 missense probably benign 0.00
R9134:Dchs1 UTSW 7 105755703 missense probably damaging 0.96
R9159:Dchs1 UTSW 7 105765919 missense probably benign
R9162:Dchs1 UTSW 7 105765525 missense probably damaging 1.00
R9169:Dchs1 UTSW 7 105772907 missense probably damaging 1.00
R9262:Dchs1 UTSW 7 105755626 missense probably damaging 1.00
R9292:Dchs1 UTSW 7 105753913 missense probably damaging 1.00
R9325:Dchs1 UTSW 7 105766195 missense possibly damaging 0.51
R9376:Dchs1 UTSW 7 105765774 critical splice donor site probably null
R9392:Dchs1 UTSW 7 105772662 missense probably benign 0.09
R9619:Dchs1 UTSW 7 105764455 missense probably benign 0.07
R9680:Dchs1 UTSW 7 105762418 missense probably damaging 1.00
R9687:Dchs1 UTSW 7 105757984 missense probably damaging 0.99
R9747:Dchs1 UTSW 7 105763475 missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105757693 missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105758551 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCGGAGTCTACCAAAAGTCCC -3'
(R):5'- ACAGTACCTGAGGACATGCC -3'

Sequencing Primer
(F):5'- GAGTCTACCAAAAGTCCCAGCATC -3'
(R):5'- ACATGCCTGTTGGAGCTGAG -3'
Posted On 2014-08-25