Incidental Mutation 'R2007:Sipa1l2'
ID222505
Institutional Source Beutler Lab
Gene Symbol Sipa1l2
Ensembl Gene ENSMUSG00000001995
Gene Namesignal-induced proliferation-associated 1 like 2
Synonyms
MMRRC Submission 040016-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R2007 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location125418063-125569808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125439437 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1486 (T1486I)
Ref Sequence ENSEMBL: ENSMUSP00000148536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]
Predicted Effect probably damaging
Transcript: ENSMUST00000108775
AA Change: T1486I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: T1486I

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
Pfam:Rap_GAP 625 807 2.6e-67 PFAM
PDZ 960 1026 6.47e-9 SMART
low complexity region 1091 1103 N/A INTRINSIC
low complexity region 1120 1138 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
low complexity region 1299 1312 N/A INTRINSIC
low complexity region 1321 1329 N/A INTRINSIC
low complexity region 1334 1355 N/A INTRINSIC
low complexity region 1404 1418 N/A INTRINSIC
Pfam:SPAR_C 1421 1666 2.5e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212168
AA Change: T1486I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212987
AA Change: T1486I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,542,892 N1387K probably benign Het
Abca13 T C 11: 9,191,987 F8L probably benign Het
Abcg5 G T 17: 84,669,920 L270M probably damaging Het
Acad10 A G 5: 121,634,751 L489S probably damaging Het
Acsf2 G A 11: 94,571,640 T183I possibly damaging Het
Adamts7 A T 9: 90,177,856 E282V probably damaging Het
Adcy4 C T 14: 55,778,313 G440R possibly damaging Het
AI429214 G A 8: 36,993,769 V24I probably benign Het
Angptl3 T C 4: 99,037,397 I320T probably damaging Het
Apoa5 A T 9: 46,270,367 Q247L possibly damaging Het
Astn1 T G 1: 158,609,305 V811G probably damaging Het
Bard1 C T 1: 71,031,403 V641I probably benign Het
Calb2 T C 8: 110,168,070 E23G probably benign Het
Cdkl4 A G 17: 80,556,301 probably benign Het
Cep85l A G 10: 53,278,075 probably benign Het
Chd1 G T 17: 15,731,006 G281V probably damaging Het
Col17a1 C T 19: 47,667,702 G586E probably damaging Het
Cpne3 T A 4: 19,553,833 D66V probably damaging Het
Csde1 A T 3: 103,044,791 I204L probably damaging Het
Dchs1 A T 7: 105,755,325 V2670E probably damaging Het
Ddx10 A G 9: 53,213,278 V428A probably benign Het
Dgkh T A 14: 78,603,049 D530V probably benign Het
Dis3l A T 9: 64,308,276 probably null Het
Dst T G 1: 34,226,012 probably benign Het
Eml6 C T 11: 29,848,814 probably null Het
En1 A T 1: 120,603,404 E124D probably benign Het
Exo1 G A 1: 175,908,530 E827K probably damaging Het
Fktn T C 4: 53,735,099 F246L possibly damaging Het
Fndc1 G A 17: 7,778,748 probably benign Het
Foxp2 G A 6: 15,396,819 C381Y probably damaging Het
Galnt6 A T 15: 100,697,166 Y485N probably damaging Het
Gemin4 G A 11: 76,212,618 A439V possibly damaging Het
Gpatch8 A G 11: 102,500,831 I155T unknown Het
Hmcn2 A G 2: 31,438,255 D4316G possibly damaging Het
Hnrnpr T A 4: 136,319,513 probably benign Het
Hpx G A 7: 105,595,574 R135C probably damaging Het
Khdrbs2 T G 1: 32,520,548 E151A probably benign Het
Krt6b A T 15: 101,678,127 L309H probably damaging Het
Lce1c G T 3: 92,680,458 C64F unknown Het
Maats1 T C 16: 38,298,254 I728V probably benign Het
March6 C T 15: 31,461,941 probably null Het
Myt1 C A 2: 181,795,759 R88S probably benign Het
Nemp1 A G 10: 127,693,577 S194G probably benign Het
Nphp4 A G 4: 152,554,654 K914R probably damaging Het
Olfr410 T A 11: 74,334,386 T282S possibly damaging Het
Osbp T C 19: 11,973,901 M270T probably benign Het
Parg T C 14: 32,210,574 M457T possibly damaging Het
Phf20 T C 2: 156,287,954 M482T probably benign Het
Pik3c2a G A 7: 116,342,237 T1598I probably damaging Het
Pkd1 T C 17: 24,579,785 M2689T probably damaging Het
Plxnd1 A T 6: 115,967,255 V1091E probably damaging Het
Ptcd2 A T 13: 99,320,236 L360Q probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Serpinc1 A T 1: 160,993,540 T65S probably benign Het
Snrnp200 T C 2: 127,227,048 L949P probably damaging Het
Ssc5d T G 7: 4,928,629 C278W probably damaging Het
Tbc1d14 T G 5: 36,571,374 H216P possibly damaging Het
Tmem183a A G 1: 134,350,123 F301S probably damaging Het
Tmem233 A C 5: 116,051,437 N94K possibly damaging Het
Tmprss13 A G 9: 45,332,545 D193G probably damaging Het
Tprkb T C 6: 85,933,048 probably benign Het
Tram1l1 A G 3: 124,321,839 H216R possibly damaging Het
Ttn A G 2: 76,734,140 V28551A probably damaging Het
Ubtfl1 A G 9: 18,409,251 N25S possibly damaging Het
Unc80 C A 1: 66,503,776 N396K probably damaging Het
Vmn1r171 T C 7: 23,632,587 L79P probably damaging Het
Vmn2r115 G T 17: 23,347,953 V480F possibly damaging Het
Xpo4 T C 14: 57,586,644 I995V probably null Het
Other mutations in Sipa1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Sipa1l2 APN 8 125491806 missense probably damaging 1.00
IGL00939:Sipa1l2 APN 8 125464435 splice site probably benign
IGL00965:Sipa1l2 APN 8 125447874 missense probably benign 0.02
IGL01321:Sipa1l2 APN 8 125491518 missense probably damaging 1.00
IGL01450:Sipa1l2 APN 8 125422577 critical splice donor site probably null
IGL01753:Sipa1l2 APN 8 125453292 splice site probably benign
IGL01930:Sipa1l2 APN 8 125419239 missense probably damaging 0.99
IGL02041:Sipa1l2 APN 8 125491819 missense probably benign 0.03
IGL02215:Sipa1l2 APN 8 125447837 missense possibly damaging 0.67
IGL02272:Sipa1l2 APN 8 125492011 missense probably damaging 1.00
IGL02370:Sipa1l2 APN 8 125480269 missense probably damaging 1.00
IGL02538:Sipa1l2 APN 8 125451977 missense probably damaging 1.00
IGL02633:Sipa1l2 APN 8 125447768 missense probably damaging 1.00
IGL03394:Sipa1l2 APN 8 125491659 missense possibly damaging 0.67
Rebellious UTSW 8 125468339 missense probably benign 0.01
R0144:Sipa1l2 UTSW 8 125449876 splice site probably null
R0153:Sipa1l2 UTSW 8 125421898 missense probably damaging 0.99
R0276:Sipa1l2 UTSW 8 125421940 missense probably damaging 1.00
R0318:Sipa1l2 UTSW 8 125447697 missense possibly damaging 0.73
R0373:Sipa1l2 UTSW 8 125464410 missense probably damaging 0.99
R0427:Sipa1l2 UTSW 8 125480332 missense probably damaging 1.00
R0634:Sipa1l2 UTSW 8 125422624 nonsense probably null
R1377:Sipa1l2 UTSW 8 125491977 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1435:Sipa1l2 UTSW 8 125468725 missense probably damaging 1.00
R1523:Sipa1l2 UTSW 8 125447613 missense possibly damaging 0.75
R1577:Sipa1l2 UTSW 8 125492262 missense probably benign 0.00
R1581:Sipa1l2 UTSW 8 125491617 missense probably damaging 0.96
R1583:Sipa1l2 UTSW 8 125421895 missense probably damaging 0.97
R1719:Sipa1l2 UTSW 8 125444535 missense probably damaging 0.99
R1730:Sipa1l2 UTSW 8 125480141 splice site probably null
R1940:Sipa1l2 UTSW 8 125480148 splice site probably benign
R2141:Sipa1l2 UTSW 8 125491491 missense probably benign 0.07
R2203:Sipa1l2 UTSW 8 125491627 missense probably damaging 0.99
R2764:Sipa1l2 UTSW 8 125492374 missense probably damaging 0.99
R3722:Sipa1l2 UTSW 8 125473584 missense probably damaging 1.00
R3787:Sipa1l2 UTSW 8 125423205 missense probably benign
R3787:Sipa1l2 UTSW 8 125450383 missense possibly damaging 0.52
R4106:Sipa1l2 UTSW 8 125492308 missense probably damaging 1.00
R4117:Sipa1l2 UTSW 8 125468510 missense probably damaging 1.00
R4194:Sipa1l2 UTSW 8 125491672 missense probably benign 0.00
R4237:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4240:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4448:Sipa1l2 UTSW 8 125492355 missense probably damaging 1.00
R4515:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4519:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4523:Sipa1l2 UTSW 8 125492424 missense probably damaging 1.00
R4557:Sipa1l2 UTSW 8 125464415 missense probably damaging 0.98
R4667:Sipa1l2 UTSW 8 125453470 missense possibly damaging 0.93
R4687:Sipa1l2 UTSW 8 125491245 missense probably damaging 1.00
R4854:Sipa1l2 UTSW 8 125473601 missense probably damaging 1.00
R4890:Sipa1l2 UTSW 8 125491867 missense probably damaging 1.00
R5065:Sipa1l2 UTSW 8 125491585 missense probably benign 0.19
R5194:Sipa1l2 UTSW 8 125439273 missense possibly damaging 0.48
R5266:Sipa1l2 UTSW 8 125492126 missense probably damaging 0.99
R5475:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R5718:Sipa1l2 UTSW 8 125491248 missense probably damaging 1.00
R5910:Sipa1l2 UTSW 8 125491684 missense probably benign 0.42
R5916:Sipa1l2 UTSW 8 125468573 missense probably damaging 1.00
R5941:Sipa1l2 UTSW 8 125473536 missense probably damaging 0.99
R6083:Sipa1l2 UTSW 8 125468473 missense possibly damaging 0.87
R6185:Sipa1l2 UTSW 8 125468253 nonsense probably null
R6235:Sipa1l2 UTSW 8 125474871 missense probably damaging 1.00
R6274:Sipa1l2 UTSW 8 125469872 missense probably damaging 1.00
R6299:Sipa1l2 UTSW 8 125453464 missense possibly damaging 0.75
R6374:Sipa1l2 UTSW 8 125444630 missense probably damaging 1.00
R6459:Sipa1l2 UTSW 8 125444484 critical splice donor site probably null
R6462:Sipa1l2 UTSW 8 125491230 missense probably damaging 1.00
R6496:Sipa1l2 UTSW 8 125449894 missense probably benign 0.00
R6543:Sipa1l2 UTSW 8 125450362 missense possibly damaging 0.50
R7154:Sipa1l2 UTSW 8 125468339 missense probably benign 0.01
R7192:Sipa1l2 UTSW 8 125422609 missense probably benign 0.09
R7240:Sipa1l2 UTSW 8 125469860 missense probably damaging 1.00
R7361:Sipa1l2 UTSW 8 125453332 missense probably damaging 1.00
R7383:Sipa1l2 UTSW 8 125447646 missense probably damaging 1.00
R7417:Sipa1l2 UTSW 8 125482106 missense possibly damaging 0.93
R7604:Sipa1l2 UTSW 8 125419272 missense probably benign 0.45
R7658:Sipa1l2 UTSW 8 125492290 missense probably benign 0.00
R7743:Sipa1l2 UTSW 8 125464233 missense probably damaging 1.00
R7781:Sipa1l2 UTSW 8 125491827 missense possibly damaging 0.46
R7812:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R7829:Sipa1l2 UTSW 8 125451988 missense probably damaging 1.00
R7880:Sipa1l2 UTSW 8 125464393 missense probably damaging 1.00
R7884:Sipa1l2 UTSW 8 125447598 missense probably benign
R8057:Sipa1l2 UTSW 8 125468530 missense probably damaging 1.00
R8082:Sipa1l2 UTSW 8 125491809 missense possibly damaging 0.82
R8092:Sipa1l2 UTSW 8 125419168 missense probably benign 0.03
R8247:Sipa1l2 UTSW 8 125422633 missense probably benign 0.29
R8252:Sipa1l2 UTSW 8 125468671 missense probably damaging 1.00
R8386:Sipa1l2 UTSW 8 125492093 missense probably damaging 1.00
X0027:Sipa1l2 UTSW 8 125492136 missense probably damaging 1.00
Z1177:Sipa1l2 UTSW 8 125447556 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AGCCCTCACTTACTCCGTAG -3'
(R):5'- ACTGCATATTTATCGTAGCGGTTTG -3'

Sequencing Primer
(F):5'- TAGGCTCCCCATGCTGG -3'
(R):5'- TTGCCATGTAGCCCAAGATG -3'
Posted On2014-08-25