Incidental Mutation 'R2014:Fga'
ID 222516
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Name fibrinogen alpha chain
Synonyms Fib, ENSMUSG00000059807
MMRRC Submission 040023-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.387) question?
Stock # R2014 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 82933460-82940934 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82940064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 573 (I573V)
Ref Sequence ENSEMBL: ENSMUSP00000133117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
AlphaFold E9PV24
Predicted Effect probably benign
Transcript: ENSMUST00000029630
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166581
AA Change: I573V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: I573V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Meta Mutation Damage Score 0.1170 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T G 17: 48,347,723 (GRCm39) T194P possibly damaging Het
Aadacl4fm5 A T 4: 144,506,295 (GRCm39) L132Q probably damaging Het
Acsbg2 T A 17: 57,160,855 (GRCm39) K263M possibly damaging Het
Adcy8 C T 15: 64,639,727 (GRCm39) G678S probably benign Het
Adgrl2 C T 3: 148,532,111 (GRCm39) G1041R probably damaging Het
Ahnak T C 19: 8,990,545 (GRCm39) I3943T probably damaging Het
Aire T C 10: 77,878,792 (GRCm39) D85G probably damaging Het
Alkbh8 C T 9: 3,343,216 (GRCm39) Q36* probably null Het
Amer3 T C 1: 34,618,525 (GRCm39) probably benign Het
Angptl8 T C 9: 21,748,358 (GRCm39) probably null Het
Ankmy1 T C 1: 92,812,863 (GRCm39) D482G probably benign Het
Apc A G 18: 34,448,644 (GRCm39) I1813V probably damaging Het
Asb13 T G 13: 3,699,512 (GRCm39) probably null Het
Blm T C 7: 80,152,147 (GRCm39) E600G probably damaging Het
Cd163 G T 6: 124,302,457 (GRCm39) W1007L probably damaging Het
Cdr1 A G X: 60,228,420 (GRCm39) F249L probably benign Het
Cp A G 3: 20,041,598 (GRCm39) K44E probably benign Het
Crtap C A 9: 114,210,653 (GRCm39) probably null Het
Ctsk A G 3: 95,414,003 (GRCm39) D250G probably damaging Het
Dcp2 T C 18: 44,543,363 (GRCm39) V307A probably benign Het
Dnah6 T A 6: 73,150,402 (GRCm39) D787V probably damaging Het
Dtx3l G A 16: 35,756,797 (GRCm39) H129Y probably benign Het
Ece2 A G 16: 20,461,067 (GRCm39) T442A probably benign Het
Espl1 C T 15: 102,231,149 (GRCm39) R17* probably null Het
Espn G T 4: 152,217,416 (GRCm39) probably null Het
Fam20b C T 1: 156,533,511 (GRCm39) R35Q possibly damaging Het
Fmo5 A G 3: 97,542,998 (GRCm39) K103E possibly damaging Het
Frem1 A T 4: 82,924,089 (GRCm39) V291D probably damaging Het
Gabbr1 A G 17: 37,367,674 (GRCm39) probably null Het
Gjb6 T C 14: 57,362,213 (GRCm39) H16R probably damaging Het
Grina T C 15: 76,132,734 (GRCm39) V167A probably damaging Het
Gulo T A 14: 66,246,496 (GRCm39) M1L probably benign Het
Hcfc2 A G 10: 82,574,814 (GRCm39) N618D probably benign Het
Heatr5b T C 17: 79,121,613 (GRCm39) D704G probably damaging Het
Hlcs A G 16: 94,063,599 (GRCm39) V487A probably benign Het
Hps1 G A 19: 42,750,951 (GRCm39) P350S probably benign Het
Hspa9 A T 18: 35,079,701 (GRCm39) Y243N probably damaging Het
Igll1 A G 16: 16,681,639 (GRCm39) S39P probably benign Het
Kif21b T C 1: 136,076,020 (GRCm39) F270L probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt27 A G 11: 99,240,318 (GRCm39) V200A probably benign Het
Lama3 T C 18: 12,657,778 (GRCm39) probably benign Het
Lmcd1 T C 6: 112,305,702 (GRCm39) W268R probably damaging Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Mamdc4 T A 2: 25,453,584 (GRCm39) D1195V probably damaging Het
Map2 T C 1: 66,455,295 (GRCm39) V1395A possibly damaging Het
Map3k20 C T 2: 72,268,604 (GRCm39) T537M probably benign Het
Mdga1 A G 17: 30,068,287 (GRCm39) S276P probably damaging Het
Mep1a T C 17: 43,808,797 (GRCm39) N85D probably benign Het
Mettl16 A G 11: 74,708,195 (GRCm39) S425G probably benign Het
Mthfd1l A G 10: 3,997,894 (GRCm39) T622A probably benign Het
Nbeal2 G A 9: 110,463,139 (GRCm39) L1309F probably benign Het
Nde1 A T 16: 13,987,321 (GRCm39) probably benign Het
Nhsl1 A T 10: 18,387,340 (GRCm39) R205W probably damaging Het
Nlrc5 A G 8: 95,252,138 (GRCm39) probably benign Het
Notch3 C A 17: 32,376,974 (GRCm39) E310D probably benign Het
Or2f1 A G 6: 42,721,784 (GRCm39) E271G probably damaging Het
Or4p19 T C 2: 88,242,388 (GRCm39) T205A probably benign Het
Or5ak24 T A 2: 85,260,696 (GRCm39) H159L possibly damaging Het
Or7a39 T C 10: 78,715,222 (GRCm39) I72T possibly damaging Het
Osbpl5 C A 7: 143,295,429 (GRCm39) C11F probably damaging Het
P4hb T C 11: 120,453,522 (GRCm39) E381G probably damaging Het
Pax4 A G 6: 28,446,209 (GRCm39) Y95H probably benign Het
Pdia3 T C 2: 121,265,301 (GRCm39) V390A probably damaging Het
Pigv A C 4: 133,390,034 (GRCm39) D49E possibly damaging Het
Pik3c2a T A 7: 115,950,166 (GRCm39) probably null Het
Plxnb1 T A 9: 108,935,687 (GRCm39) probably benign Het
Polq A G 16: 36,898,728 (GRCm39) T2163A probably damaging Het
Pou5f2 T C 13: 78,173,972 (GRCm39) S305P probably benign Het
Ppm1h A T 10: 122,756,630 (GRCm39) H425L possibly damaging Het
Ppp1r13b G T 12: 111,800,222 (GRCm39) D518E probably benign Het
Prf1 A T 10: 61,139,674 (GRCm39) D544V probably benign Het
Prl3b1 T C 13: 27,431,948 (GRCm39) F158L probably benign Het
Prss41 C T 17: 24,056,464 (GRCm39) probably null Het
Prune2 T G 19: 17,097,887 (GRCm39) N1130K probably damaging Het
Ptgdr2 T C 19: 10,917,789 (GRCm39) F102S probably damaging Het
Ptprq T G 10: 107,503,283 (GRCm39) K792Q probably damaging Het
Pttg1ip2 T A 5: 5,505,964 (GRCm39) I106L probably benign Het
Rcbtb2 T C 14: 73,411,826 (GRCm39) probably benign Het
Rgs14 C A 13: 55,531,513 (GRCm39) S479* probably null Het
Sash1 A T 10: 8,605,177 (GRCm39) V1071D probably benign Het
Sdsl G A 5: 120,601,218 (GRCm39) T18M probably damaging Het
Sepsecs T A 5: 52,804,966 (GRCm39) Q365L probably benign Het
Sh2d4a A T 8: 68,783,735 (GRCm39) Q223L probably damaging Het
Slc14a2 T C 18: 78,193,601 (GRCm39) probably benign Het
Slc5a9 A C 4: 111,753,546 (GRCm39) S52A possibly damaging Het
Slc6a18 C A 13: 73,823,844 (GRCm39) V99L probably benign Het
Smarca2 T C 19: 26,661,305 (GRCm39) S967P possibly damaging Het
Tbc1d22a C T 15: 86,183,885 (GRCm39) T248M probably damaging Het
Tcte1 A T 17: 45,852,237 (GRCm39) N490I probably benign Het
Tet3 T C 6: 83,363,057 (GRCm39) E705G probably damaging Het
Tfeb T A 17: 48,102,484 (GRCm39) H450Q probably damaging Het
Tmem248 G A 5: 130,260,653 (GRCm39) E73K probably damaging Het
Trip12 A T 1: 84,738,587 (GRCm39) L756* probably null Het
Try5 C T 6: 41,291,585 (GRCm39) probably null Het
Tsc1 A T 2: 28,555,649 (GRCm39) probably benign Het
Tspear G A 10: 77,710,954 (GRCm39) probably benign Het
Ttc6 T C 12: 57,623,003 (GRCm39) I134T possibly damaging Het
Ttn T A 2: 76,585,640 (GRCm39) probably null Het
Ube3b A G 5: 114,549,210 (GRCm39) E738G probably damaging Het
Usp36 T C 11: 118,153,334 (GRCm39) probably benign Het
Vmn2r71 T A 7: 85,269,845 (GRCm39) M452K probably benign Het
Vps13b T C 15: 35,607,288 (GRCm39) S1074P probably damaging Het
Vps13d A G 4: 144,835,078 (GRCm39) S2757P probably damaging Het
Vwde C A 6: 13,208,337 (GRCm39) G182C possibly damaging Het
Wdr33 T C 18: 31,966,652 (GRCm39) V164A probably damaging Het
Zkscan16 A G 4: 58,956,525 (GRCm39) Y269C possibly damaging Het
Zup1 A G 10: 33,805,820 (GRCm39) V437A possibly damaging Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 82,938,981 (GRCm39) missense probably damaging 1.00
IGL00478:Fga APN 3 82,935,951 (GRCm39) missense probably benign 0.00
IGL00587:Fga APN 3 82,937,596 (GRCm39) missense possibly damaging 0.62
IGL01289:Fga APN 3 82,938,552 (GRCm39) missense possibly damaging 0.85
IGL01323:Fga APN 3 82,937,518 (GRCm39) missense probably damaging 0.99
IGL01369:Fga APN 3 82,937,507 (GRCm39) missense probably benign 0.00
IGL01409:Fga APN 3 82,940,059 (GRCm39) missense probably damaging 1.00
IGL01541:Fga APN 3 82,940,014 (GRCm39) missense probably damaging 1.00
IGL01633:Fga APN 3 82,937,606 (GRCm39) missense possibly damaging 0.89
IGL01966:Fga APN 3 82,936,461 (GRCm39) missense probably damaging 0.97
IGL02651:Fga APN 3 82,935,841 (GRCm39) missense probably benign 0.00
IGL02822:Fga APN 3 82,938,789 (GRCm39) missense probably damaging 1.00
IGL03003:Fga APN 3 82,940,037 (GRCm39) missense probably damaging 1.00
R0336:Fga UTSW 3 82,938,164 (GRCm39) missense probably damaging 1.00
R0540:Fga UTSW 3 82,935,869 (GRCm39) missense probably damaging 1.00
R0607:Fga UTSW 3 82,935,869 (GRCm39) missense probably damaging 1.00
R1471:Fga UTSW 3 82,935,925 (GRCm39) missense probably benign 0.16
R1517:Fga UTSW 3 82,939,145 (GRCm39) missense probably benign 0.00
R1817:Fga UTSW 3 82,939,082 (GRCm39) missense probably benign 0.00
R1874:Fga UTSW 3 82,940,028 (GRCm39) missense probably damaging 1.00
R2267:Fga UTSW 3 82,940,257 (GRCm39) missense probably damaging 1.00
R2332:Fga UTSW 3 82,938,704 (GRCm39) missense probably damaging 1.00
R2420:Fga UTSW 3 82,940,461 (GRCm39) missense possibly damaging 0.53
R2443:Fga UTSW 3 82,935,848 (GRCm39) missense probably benign 0.03
R3978:Fga UTSW 3 82,937,490 (GRCm39) critical splice acceptor site probably null
R4597:Fga UTSW 3 82,938,542 (GRCm39) nonsense probably null
R4644:Fga UTSW 3 82,937,573 (GRCm39) missense possibly damaging 0.81
R4760:Fga UTSW 3 82,938,821 (GRCm39) missense probably benign
R4867:Fga UTSW 3 82,935,951 (GRCm39) missense probably benign 0.00
R5449:Fga UTSW 3 82,938,169 (GRCm39) frame shift probably null
R5507:Fga UTSW 3 82,940,643 (GRCm39) missense probably damaging 1.00
R5712:Fga UTSW 3 82,940,440 (GRCm39) missense possibly damaging 0.70
R6853:Fga UTSW 3 82,938,219 (GRCm39) missense probably damaging 1.00
R6865:Fga UTSW 3 82,938,848 (GRCm39) missense probably damaging 1.00
R7163:Fga UTSW 3 82,933,571 (GRCm39) missense probably benign 0.04
R7724:Fga UTSW 3 82,936,432 (GRCm39) missense probably damaging 0.99
R8153:Fga UTSW 3 82,938,164 (GRCm39) missense probably damaging 1.00
R8506:Fga UTSW 3 82,940,623 (GRCm39) missense probably damaging 1.00
R8511:Fga UTSW 3 82,939,064 (GRCm39) nonsense probably null
R8523:Fga UTSW 3 82,938,158 (GRCm39) missense probably damaging 1.00
R8801:Fga UTSW 3 82,938,188 (GRCm39) missense possibly damaging 0.89
R8906:Fga UTSW 3 82,939,111 (GRCm39) missense probably benign 0.12
R9390:Fga UTSW 3 82,940,610 (GRCm39) missense probably damaging 1.00
R9609:Fga UTSW 3 82,940,064 (GRCm39) missense probably damaging 1.00
X0062:Fga UTSW 3 82,937,578 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CATTGTAGGTGCATCCTTTTCG -3'
(R):5'- AGGTAGTCATTGCCTAGCCAG -3'

Sequencing Primer
(F):5'- CATCCTTTTCGTGTGGGAGGAG -3'
(R):5'- GGTAGTCATTGCCTAGCCAGAATTC -3'
Posted On 2014-08-25