Incidental Mutation 'R0140:Atp4a'
ID 22252
Institutional Source Beutler Lab
Gene Symbol Atp4a
Ensembl Gene ENSMUSG00000005553
Gene Name ATPase, H+/K+ exchanging, gastric, alpha polypeptide
Synonyms H+K+-transporting alpha 1, H+/K+-ATPase alpha
MMRRC Submission 038425-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R0140 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 7
Chromosomal Location 30411634-30424959 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 30419526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 659 (R659G)
Ref Sequence ENSEMBL: ENSMUSP00000131964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005692
AA Change: R659G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: R659G

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167761
Predicted Effect probably benign
Transcript: ENSMUST00000170371
AA Change: R659G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: R659G

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171014
Meta Mutation Damage Score 0.0961 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,057,789 (GRCm39) probably benign Het
9330161L09Rik T C 12: 103,373,587 (GRCm39) probably benign Het
Abca2 T G 2: 25,328,097 (GRCm39) probably null Het
Adgrf3 T C 5: 30,401,379 (GRCm39) K13R probably benign Het
Arhgap15 C A 2: 44,212,779 (GRCm39) F416L probably damaging Het
Arhgef26 C G 3: 62,355,666 (GRCm39) T746R probably benign Het
Aspm C T 1: 139,408,379 (GRCm39) T2422I probably benign Het
AY358078 T A 14: 52,063,399 (GRCm39) D348E probably benign Het
Blnk A T 19: 40,928,668 (GRCm39) S285T probably damaging Het
Calr3 C T 8: 73,188,732 (GRCm39) probably benign Het
Camsap2 A T 1: 136,208,120 (GRCm39) V1124D probably benign Het
Ccdc40 G A 11: 119,155,125 (GRCm39) G1122S probably benign Het
Ccdc69 C A 11: 54,941,325 (GRCm39) C196F possibly damaging Het
Cdhr3 T G 12: 33,130,412 (GRCm39) N141T probably benign Het
Cdk4 T C 10: 126,900,214 (GRCm39) V37A probably damaging Het
Celsr2 C T 3: 108,305,249 (GRCm39) R2110K probably benign Het
Clcn7 A G 17: 25,372,728 (GRCm39) Y437C probably damaging Het
Col6a6 A G 9: 105,579,474 (GRCm39) F1917S probably damaging Het
Cps1 T G 1: 67,219,275 (GRCm39) S872A probably benign Het
Crebbp G T 16: 3,935,363 (GRCm39) T842N probably damaging Het
Dennd2d G A 3: 106,399,799 (GRCm39) V234I probably benign Het
Fam227b T C 2: 125,966,523 (GRCm39) M130V possibly damaging Het
Fbxw24 G T 9: 109,434,482 (GRCm39) L373I possibly damaging Het
Fubp3 T C 2: 31,498,196 (GRCm39) Y359H probably damaging Het
Gm19684 T C 17: 36,438,319 (GRCm39) probably benign Het
Hrnr C T 3: 93,238,800 (GRCm39) Q3013* probably null Het
Il12rb1 T C 8: 71,272,415 (GRCm39) probably benign Het
Lepr A T 4: 101,625,264 (GRCm39) D473V probably damaging Het
Myof A T 19: 37,940,004 (GRCm39) Y820* probably null Het
Nfil3 G A 13: 53,121,681 (GRCm39) Q408* probably null Het
Nolc1 G A 19: 46,069,817 (GRCm39) probably benign Het
Npbwr1 A C 1: 5,986,840 (GRCm39) Y225D probably damaging Het
Nrip3 T C 7: 109,361,022 (GRCm39) probably benign Het
Ntrk1 A C 3: 87,685,875 (GRCm39) L749R probably damaging Het
Or10ag53 A G 2: 87,082,969 (GRCm39) I229M probably damaging Het
Or2b11 A G 11: 59,461,804 (GRCm39) L254P probably damaging Het
Or4c126 T A 2: 89,824,463 (GRCm39) V242D probably damaging Het
Or52a24 A G 7: 103,381,349 (GRCm39) D72G probably damaging Het
Or6c211 G T 10: 129,505,557 (GRCm39) T277N probably damaging Het
Paox A T 7: 139,713,971 (GRCm39) T244S probably damaging Het
Pcdhb9 T A 18: 37,536,014 (GRCm39) D669E possibly damaging Het
Pggt1b A G 18: 46,391,150 (GRCm39) probably null Het
Phkg1 T A 5: 129,893,449 (GRCm39) I334F probably benign Het
Phtf1 A T 3: 103,894,876 (GRCm39) R208W probably null Het
Pnliprp2 A T 19: 58,754,795 (GRCm39) I280F probably benign Het
Pnma8a A G 7: 16,694,147 (GRCm39) M1V probably null Het
Prcp A G 7: 92,577,819 (GRCm39) T328A probably damaging Het
Pxdn A G 12: 30,032,753 (GRCm39) E179G probably benign Het
Racgap1 A T 15: 99,521,532 (GRCm39) N541K probably benign Het
Rnf103 T A 6: 71,486,315 (GRCm39) F315L possibly damaging Het
Septin2 A G 1: 93,429,361 (GRCm39) R237G probably damaging Het
Setd6 T A 8: 96,442,737 (GRCm39) L58Q probably damaging Het
Sipa1l1 G A 12: 82,442,974 (GRCm39) V755I probably damaging Het
Slc16a12 G T 19: 34,650,104 (GRCm39) probably benign Het
Slk G A 19: 47,610,774 (GRCm39) D815N probably damaging Het
Stx1a T C 5: 135,074,439 (GRCm39) probably benign Het
Tbc1d15 T A 10: 115,056,124 (GRCm39) I283F probably damaging Het
Tenm4 T C 7: 96,545,259 (GRCm39) I2425T possibly damaging Het
Tle1 G A 4: 72,038,422 (GRCm39) H702Y probably damaging Het
Tmc6 A G 11: 117,657,077 (GRCm39) probably benign Het
Tmem268 G A 4: 63,496,096 (GRCm39) R179H possibly damaging Het
Tmem9 A G 1: 135,961,900 (GRCm39) K165R probably damaging Het
Trpm6 A G 19: 18,796,558 (GRCm39) probably null Het
Tufm C T 7: 126,089,003 (GRCm39) P88S probably damaging Het
Ubqln1 A G 13: 58,341,103 (GRCm39) I216T probably damaging Het
Urad T G 5: 147,259,141 (GRCm39) M1L probably benign Het
Utp6 A G 11: 79,847,551 (GRCm39) probably benign Het
Vav2 C T 2: 27,163,688 (GRCm39) probably benign Het
Vmn2r55 G T 7: 12,402,104 (GRCm39) Q395K possibly damaging Het
Wwox T G 8: 115,433,027 (GRCm39) V231G probably damaging Het
Zfp646 T A 7: 127,482,678 (GRCm39) N1618K probably benign Het
Zzef1 G A 11: 72,790,377 (GRCm39) M2110I possibly damaging Het
Other mutations in Atp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Atp4a APN 7 30,412,629 (GRCm39) missense possibly damaging 0.95
IGL01327:Atp4a APN 7 30,412,675 (GRCm39) missense possibly damaging 0.96
IGL01510:Atp4a APN 7 30,420,216 (GRCm39) missense probably benign 0.02
IGL01763:Atp4a APN 7 30,414,943 (GRCm39) missense probably benign 0.20
IGL02061:Atp4a APN 7 30,414,454 (GRCm39) missense probably damaging 1.00
IGL02435:Atp4a APN 7 30,416,482 (GRCm39) missense probably benign
IGL02903:Atp4a APN 7 30,415,344 (GRCm39) missense probably benign 0.00
IGL03181:Atp4a APN 7 30,424,129 (GRCm39) missense probably benign 0.02
IGL03350:Atp4a APN 7 30,420,292 (GRCm39) missense probably damaging 1.00
atypical UTSW 7 30,414,781 (GRCm39) missense possibly damaging 0.84
sublytic UTSW 7 30,415,225 (GRCm39) missense probably benign 0.32
IGL03097:Atp4a UTSW 7 30,422,462 (GRCm39) missense probably benign 0.14
R0095:Atp4a UTSW 7 30,420,160 (GRCm39) missense probably damaging 0.99
R0121:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0241:Atp4a UTSW 7 30,416,560 (GRCm39) missense probably benign 0.00
R0437:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0624:Atp4a UTSW 7 30,418,424 (GRCm39) missense probably benign
R1164:Atp4a UTSW 7 30,417,117 (GRCm39) missense probably benign 0.00
R2105:Atp4a UTSW 7 30,419,793 (GRCm39) critical splice donor site probably null
R2272:Atp4a UTSW 7 30,414,925 (GRCm39) nonsense probably null
R2327:Atp4a UTSW 7 30,419,666 (GRCm39) missense probably benign 0.16
R2881:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2990:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2992:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2993:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3123:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3125:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3441:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3442:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3686:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3687:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3845:Atp4a UTSW 7 30,416,540 (GRCm39) missense probably null 0.99
R4027:Atp4a UTSW 7 30,424,377 (GRCm39) splice site probably null
R4072:Atp4a UTSW 7 30,414,757 (GRCm39) missense probably benign 0.09
R4433:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4454:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4457:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4458:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4510:Atp4a UTSW 7 30,423,678 (GRCm39) nonsense probably null
R4511:Atp4a UTSW 7 30,423,678 (GRCm39) nonsense probably null
R4576:Atp4a UTSW 7 30,417,147 (GRCm39) missense probably benign 0.25
R4656:Atp4a UTSW 7 30,419,373 (GRCm39) intron probably benign
R4661:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4662:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4852:Atp4a UTSW 7 30,423,693 (GRCm39) missense probably benign 0.10
R4892:Atp4a UTSW 7 30,411,899 (GRCm39) missense probably benign 0.07
R4907:Atp4a UTSW 7 30,418,517 (GRCm39) missense possibly damaging 0.66
R5024:Atp4a UTSW 7 30,415,289 (GRCm39) missense possibly damaging 0.82
R5254:Atp4a UTSW 7 30,414,955 (GRCm39) missense probably damaging 1.00
R5318:Atp4a UTSW 7 30,414,754 (GRCm39) missense probably damaging 1.00
R5340:Atp4a UTSW 7 30,420,231 (GRCm39) missense probably benign
R5484:Atp4a UTSW 7 30,420,097 (GRCm39) unclassified probably benign
R5729:Atp4a UTSW 7 30,411,851 (GRCm39) missense possibly damaging 0.48
R5762:Atp4a UTSW 7 30,418,521 (GRCm39) missense probably damaging 0.99
R5797:Atp4a UTSW 7 30,412,074 (GRCm39) missense probably damaging 1.00
R6030:Atp4a UTSW 7 30,421,941 (GRCm39) missense probably damaging 0.99
R6030:Atp4a UTSW 7 30,421,941 (GRCm39) missense probably damaging 0.99
R6077:Atp4a UTSW 7 30,415,344 (GRCm39) missense probably benign 0.00
R6243:Atp4a UTSW 7 30,415,382 (GRCm39) missense possibly damaging 0.68
R6346:Atp4a UTSW 7 30,414,781 (GRCm39) missense possibly damaging 0.84
R6459:Atp4a UTSW 7 30,411,887 (GRCm39) missense probably benign 0.00
R6515:Atp4a UTSW 7 30,411,903 (GRCm39) missense possibly damaging 0.78
R6773:Atp4a UTSW 7 30,414,802 (GRCm39) missense probably damaging 0.98
R6854:Atp4a UTSW 7 30,414,433 (GRCm39) missense probably benign 0.29
R7215:Atp4a UTSW 7 30,416,785 (GRCm39) missense possibly damaging 0.61
R7271:Atp4a UTSW 7 30,421,944 (GRCm39) missense probably benign 0.16
R7340:Atp4a UTSW 7 30,416,155 (GRCm39) missense possibly damaging 0.94
R7457:Atp4a UTSW 7 30,420,192 (GRCm39) missense probably benign 0.08
R7593:Atp4a UTSW 7 30,424,105 (GRCm39) missense probably benign 0.08
R7712:Atp4a UTSW 7 30,414,978 (GRCm39) missense probably damaging 0.96
R7762:Atp4a UTSW 7 30,419,461 (GRCm39) missense probably damaging 0.96
R8714:Atp4a UTSW 7 30,420,013 (GRCm39) missense probably damaging 0.99
R9324:Atp4a UTSW 7 30,415,207 (GRCm39) missense probably benign 0.02
Z1177:Atp4a UTSW 7 30,417,265 (GRCm39) missense possibly damaging 0.47
Z1186:Atp4a UTSW 7 30,416,782 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGGACATTGCTCTGATCTGAAGG -3'
(R):5'- CAATCACCAGCTTCTGCTGAGGAC -3'

Sequencing Primer
(F):5'- CTCTGATCTGAAGGGGTGAAG -3'
(R):5'- TCAGTCAGTGTGGGTTGCA -3'
Posted On 2013-04-16