Mutagenetix > Incidental Mutation

Incidental Mutation 'R0140:Atp4a'

22252

Institutional Source

Beutler Lab

Gene Symbol

Atp4a

Ensembl Gene

ENSMUSG00000005553

Gene Name

ATPase, H+/K+ exchanging, gastric, alpha polypeptide

Synonyms

H+/K+-ATPase alpha, H+K+-transporting alpha 1

MMRRC Submission

038425-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R0140 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

30712209-30725534 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 30720101 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 659 (R659G)

Ref Sequence

ENSEMBL: ENSMUSP00000131964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000005692
AA Change: R659G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: R659G

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	5.4e-23	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	144	375	1.1e-57	PFAM
Pfam:Hydrolase	380	739	5.3e-16	PFAM
Pfam:HAD	383	736	1.9e-18	PFAM
Pfam:Cation_ATPase	436	531	1.6e-24	PFAM
Pfam:Cation_ATPase_C	809	1019	4.8e-43	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167761

Predicted Effect

probably benign
Transcript: ENSMUST00000170371
AA Change: R659G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: R659G

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	4.9e-28	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	145	376	1e-62	PFAM
Pfam:Hydrolase	380	730	9.3e-25	PFAM
Pfam:HAD	383	727	2.1e-15	PFAM
Pfam:Hydrolase_like2	436	531	4e-25	PFAM
Pfam:Cation_ATPase_C	800	1010	1.5e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171014

Meta Mutation Damage Score

0.0961

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,295,159		probably benign	Het
9330161L09Rik	T	C	12: 103,407,328		probably benign	Het
Abca2	T	G	2: 25,438,085		probably null	Het
Adgrf3	T	C	5: 30,196,381	K13R	probably benign	Het
Arhgap15	C	A	2: 44,322,767	F416L	probably damaging	Het
Arhgef26	C	G	3: 62,448,245	T746R	probably benign	Het
Aspm	C	T	1: 139,480,641	T2422I	probably benign	Het
AY358078	T	A	14: 51,825,942	D348E	probably benign	Het
Blnk	A	T	19: 40,940,224	S285T	probably damaging	Het
Calr3	C	T	8: 72,434,888		probably benign	Het
Camsap2	A	T	1: 136,280,382	V1124D	probably benign	Het
Ccdc40	G	A	11: 119,264,299	G1122S	probably benign	Het
Ccdc69	C	A	11: 55,050,499	C196F	possibly damaging	Het
Cdhr3	T	G	12: 33,080,413	N141T	probably benign	Het
Cdk4	T	C	10: 127,064,345	V37A	probably damaging	Het
Celsr2	C	T	3: 108,397,933	R2110K	probably benign	Het
Clcn7	A	G	17: 25,153,754	Y437C	probably damaging	Het
Col6a6	A	G	9: 105,702,275	F1917S	probably damaging	Het
Cps1	T	G	1: 67,180,116	S872A	probably benign	Het
Crebbp	G	T	16: 4,117,499	T842N	probably damaging	Het
Dennd2d	G	A	3: 106,492,483	V234I	probably benign	Het
Fam227b	T	C	2: 126,124,603	M130V	possibly damaging	Het
Fbxw24	G	T	9: 109,605,414	L373I	possibly damaging	Het
Fubp3	T	C	2: 31,608,184	Y359H	probably damaging	Het
Gm19684	T	C	17: 36,127,427		probably benign	Het
Hrnr	C	T	3: 93,331,493	Q3013*	probably null	Het
Il12rb1	T	C	8: 70,819,771		probably benign	Het
Lepr	A	T	4: 101,768,067	D473V	probably damaging	Het
Myof	A	T	19: 37,951,556	Y820*	probably null	Het
Nfil3	G	A	13: 52,967,645	Q408*	probably null	Het
Nolc1	G	A	19: 46,081,378		probably benign	Het
Npbwr1	A	C	1: 5,916,621	Y225D	probably damaging	Het
Nrip3	T	C	7: 109,761,815		probably benign	Het
Ntrk1	A	C	3: 87,778,568	L749R	probably damaging	Het
Olfr1115	A	G	2: 87,252,625	I229M	probably damaging	Het
Olfr1261	T	A	2: 89,994,119	V242D	probably damaging	Het
Olfr222	A	G	11: 59,570,978	L254P	probably damaging	Het
Olfr628	A	G	7: 103,732,142	D72G	probably damaging	Het
Olfr801	G	T	10: 129,669,688	T277N	probably damaging	Het
Paox	A	T	7: 140,134,058	T244S	probably damaging	Het
Pcdhb9	T	A	18: 37,402,961	D669E	possibly damaging	Het
Pggt1b	A	G	18: 46,258,083		probably null	Het
Phkg1	T	A	5: 129,864,608	I334F	probably benign	Het
Phtf1	A	T	3: 103,987,560	R208W	probably null	Het
Pnliprp2	A	T	19: 58,766,363	I280F	probably benign	Het
Pnmal1	A	G	7: 16,960,222	M1V	probably null	Het
Prcp	A	G	7: 92,928,611	T328A	probably damaging	Het
Pxdn	A	G	12: 29,982,754	E179G	probably benign	Het
Racgap1	A	T	15: 99,623,651	N541K	probably benign	Het
Rnf103	T	A	6: 71,509,331	F315L	possibly damaging	Het
Sept2	A	G	1: 93,501,639	R237G	probably damaging	Het
Setd6	T	A	8: 95,716,109	L58Q	probably damaging	Het
Sipa1l1	G	A	12: 82,396,200	V755I	probably damaging	Het
Slc16a12	G	T	19: 34,672,704		probably benign	Het
Slk	G	A	19: 47,622,335	D815N	probably damaging	Het
Stx1a	T	C	5: 135,045,585		probably benign	Het
Tbc1d15	T	A	10: 115,220,219	I283F	probably damaging	Het
Tenm4	T	C	7: 96,896,052	I2425T	possibly damaging	Het
Tle1	G	A	4: 72,120,185	H702Y	probably damaging	Het
Tmc6	A	G	11: 117,766,251		probably benign	Het
Tmem268	G	A	4: 63,577,859	R179H	possibly damaging	Het
Tmem9	A	G	1: 136,034,162	K165R	probably damaging	Het
Trpm6	A	G	19: 18,819,194		probably null	Het
Tufm	C	T	7: 126,489,831	P88S	probably damaging	Het
Ubqln1	A	G	13: 58,193,289	I216T	probably damaging	Het
Urad	T	G	5: 147,322,331	M1L	probably benign	Het
Utp6	A	G	11: 79,956,725		probably benign	Het
Vav2	C	T	2: 27,273,676		probably benign	Het
Vmn2r55	G	T	7: 12,668,177	Q395K	possibly damaging	Het
Wwox	T	G	8: 114,706,287	V231G	probably damaging	Het
Zfp646	T	A	7: 127,883,506	N1618K	probably benign	Het
Zzef1	G	A	11: 72,899,551	M2110I	possibly damaging	Het

Other mutations in Atp4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Atp4a	APN	7	30713204	missense	possibly damaging	0.95
IGL01327:Atp4a	APN	7	30713250	missense	possibly damaging	0.96
IGL01510:Atp4a	APN	7	30720791	missense	probably benign	0.02
IGL01763:Atp4a	APN	7	30715518	missense	probably benign	0.20
IGL02061:Atp4a	APN	7	30715029	missense	probably damaging	1.00
IGL02435:Atp4a	APN	7	30717057	missense	probably benign
IGL02903:Atp4a	APN	7	30715919	missense	probably benign	0.00
IGL03181:Atp4a	APN	7	30724704	missense	probably benign	0.02
IGL03350:Atp4a	APN	7	30720867	missense	probably damaging	1.00
atypical	UTSW	7	30715356	missense	possibly damaging	0.84
sublytic	UTSW	7	30715800	missense	probably benign	0.32
IGL03097:Atp4a	UTSW	7	30723037	missense	probably benign	0.14
R0095:Atp4a	UTSW	7	30720735	missense	probably damaging	0.99
R0121:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0241:Atp4a	UTSW	7	30717135	missense	probably benign	0.00
R0437:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0624:Atp4a	UTSW	7	30718999	missense	probably benign
R1164:Atp4a	UTSW	7	30717692	missense	probably benign	0.00
R2105:Atp4a	UTSW	7	30720368	critical splice donor site	probably null
R2272:Atp4a	UTSW	7	30715500	nonsense	probably null
R2327:Atp4a	UTSW	7	30720241	missense	probably benign	0.16
R2881:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2990:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2992:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2993:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3123:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3125:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3441:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3442:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3686:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3687:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3845:Atp4a	UTSW	7	30717115	missense	probably null	0.99
R4027:Atp4a	UTSW	7	30724952	splice site	probably null
R4072:Atp4a	UTSW	7	30715332	missense	probably benign	0.09
R4433:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4454:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4457:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4458:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4510:Atp4a	UTSW	7	30724253	nonsense	probably null
R4511:Atp4a	UTSW	7	30724253	nonsense	probably null
R4576:Atp4a	UTSW	7	30717722	missense	probably benign	0.25
R4656:Atp4a	UTSW	7	30719948	intron	probably benign
R4661:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4662:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4852:Atp4a	UTSW	7	30724268	missense	probably benign	0.10
R4892:Atp4a	UTSW	7	30712474	missense	probably benign	0.07
R4907:Atp4a	UTSW	7	30719092	missense	possibly damaging	0.66
R5024:Atp4a	UTSW	7	30715864	missense	possibly damaging	0.82
R5254:Atp4a	UTSW	7	30715530	missense	probably damaging	1.00
R5318:Atp4a	UTSW	7	30715329	missense	probably damaging	1.00
R5340:Atp4a	UTSW	7	30720806	missense	probably benign
R5484:Atp4a	UTSW	7	30720672	unclassified	probably benign
R5729:Atp4a	UTSW	7	30712426	missense	possibly damaging	0.48
R5762:Atp4a	UTSW	7	30719096	missense	probably damaging	0.99
R5797:Atp4a	UTSW	7	30712649	missense	probably damaging	1.00
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6077:Atp4a	UTSW	7	30715919	missense	probably benign	0.00
R6243:Atp4a	UTSW	7	30715957	missense	possibly damaging	0.68
R6346:Atp4a	UTSW	7	30715356	missense	possibly damaging	0.84
R6459:Atp4a	UTSW	7	30712462	missense	probably benign	0.00
R6515:Atp4a	UTSW	7	30712478	missense	possibly damaging	0.78
R6773:Atp4a	UTSW	7	30715377	missense	probably damaging	0.98
R6854:Atp4a	UTSW	7	30715008	missense	probably benign	0.29
R7215:Atp4a	UTSW	7	30717360	missense	possibly damaging	0.61
R7271:Atp4a	UTSW	7	30722519	missense	probably benign	0.16
R7340:Atp4a	UTSW	7	30716730	missense	possibly damaging	0.94
R7457:Atp4a	UTSW	7	30720767	missense	probably benign	0.08
R7593:Atp4a	UTSW	7	30724680	missense	probably benign	0.08
R7712:Atp4a	UTSW	7	30715553	missense	probably damaging	0.96
R7762:Atp4a	UTSW	7	30720036	missense	probably damaging	0.96
R8714:Atp4a	UTSW	7	30720588	missense	probably damaging	0.99
R9324:Atp4a	UTSW	7	30715782	missense	probably benign	0.02
Z1177:Atp4a	UTSW	7	30717840	missense	possibly damaging	0.47
Z1186:Atp4a	UTSW	7	30717357	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGGGACATTGCTCTGATCTGAAGG -3'
(R):5'- CAATCACCAGCTTCTGCTGAGGAC -3'

Sequencing Primer
(F):5'- CTCTGATCTGAAGGGGTGAAG -3'
(R):5'- TCAGTCAGTGTGGGTTGCA -3'

Posted On

2013-04-16