Incidental Mutation 'R2007:Rbp3'
ID222545
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Nameretinol binding protein 3, interstitial
SynonymsRbp-3, Irbp
MMRRC Submission 040016-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R2007 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location33954003-33964216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33956018 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 641 (T641M)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
Predicted Effect probably damaging
Transcript: ENSMUST00000035695
AA Change: T641M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: T641M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,542,892 N1387K probably benign Het
Abca13 T C 11: 9,191,987 F8L probably benign Het
Abcg5 G T 17: 84,669,920 L270M probably damaging Het
Acad10 A G 5: 121,634,751 L489S probably damaging Het
Acsf2 G A 11: 94,571,640 T183I possibly damaging Het
Adamts7 A T 9: 90,177,856 E282V probably damaging Het
Adcy4 C T 14: 55,778,313 G440R possibly damaging Het
AI429214 G A 8: 36,993,769 V24I probably benign Het
Angptl3 T C 4: 99,037,397 I320T probably damaging Het
Apoa5 A T 9: 46,270,367 Q247L possibly damaging Het
Astn1 T G 1: 158,609,305 V811G probably damaging Het
Bard1 C T 1: 71,031,403 V641I probably benign Het
Calb2 T C 8: 110,168,070 E23G probably benign Het
Cdkl4 A G 17: 80,556,301 probably benign Het
Cep85l A G 10: 53,278,075 probably benign Het
Chd1 G T 17: 15,731,006 G281V probably damaging Het
Col17a1 C T 19: 47,667,702 G586E probably damaging Het
Cpne3 T A 4: 19,553,833 D66V probably damaging Het
Csde1 A T 3: 103,044,791 I204L probably damaging Het
Dchs1 A T 7: 105,755,325 V2670E probably damaging Het
Ddx10 A G 9: 53,213,278 V428A probably benign Het
Dgkh T A 14: 78,603,049 D530V probably benign Het
Dis3l A T 9: 64,308,276 probably null Het
Dst T G 1: 34,226,012 probably benign Het
Eml6 C T 11: 29,848,814 probably null Het
En1 A T 1: 120,603,404 E124D probably benign Het
Exo1 G A 1: 175,908,530 E827K probably damaging Het
Fktn T C 4: 53,735,099 F246L possibly damaging Het
Fndc1 G A 17: 7,778,748 probably benign Het
Foxp2 G A 6: 15,396,819 C381Y probably damaging Het
Galnt6 A T 15: 100,697,166 Y485N probably damaging Het
Gemin4 G A 11: 76,212,618 A439V possibly damaging Het
Gpatch8 A G 11: 102,500,831 I155T unknown Het
Hmcn2 A G 2: 31,438,255 D4316G possibly damaging Het
Hnrnpr T A 4: 136,319,513 probably benign Het
Hpx G A 7: 105,595,574 R135C probably damaging Het
Khdrbs2 T G 1: 32,520,548 E151A probably benign Het
Krt6b A T 15: 101,678,127 L309H probably damaging Het
Lce1c G T 3: 92,680,458 C64F unknown Het
Maats1 T C 16: 38,298,254 I728V probably benign Het
March6 C T 15: 31,461,941 probably null Het
Myt1 C A 2: 181,795,759 R88S probably benign Het
Nemp1 A G 10: 127,693,577 S194G probably benign Het
Nphp4 A G 4: 152,554,654 K914R probably damaging Het
Olfr410 T A 11: 74,334,386 T282S possibly damaging Het
Osbp T C 19: 11,973,901 M270T probably benign Het
Parg T C 14: 32,210,574 M457T possibly damaging Het
Phf20 T C 2: 156,287,954 M482T probably benign Het
Pik3c2a G A 7: 116,342,237 T1598I probably damaging Het
Pkd1 T C 17: 24,579,785 M2689T probably damaging Het
Plxnd1 A T 6: 115,967,255 V1091E probably damaging Het
Ptcd2 A T 13: 99,320,236 L360Q probably damaging Het
Serpinc1 A T 1: 160,993,540 T65S probably benign Het
Sipa1l2 G A 8: 125,439,437 T1486I probably damaging Het
Snrnp200 T C 2: 127,227,048 L949P probably damaging Het
Ssc5d T G 7: 4,928,629 C278W probably damaging Het
Tbc1d14 T G 5: 36,571,374 H216P possibly damaging Het
Tmem183a A G 1: 134,350,123 F301S probably damaging Het
Tmem233 A C 5: 116,051,437 N94K possibly damaging Het
Tmprss13 A G 9: 45,332,545 D193G probably damaging Het
Tprkb T C 6: 85,933,048 probably benign Het
Tram1l1 A G 3: 124,321,839 H216R possibly damaging Het
Ttn A G 2: 76,734,140 V28551A probably damaging Het
Ubtfl1 A G 9: 18,409,251 N25S possibly damaging Het
Unc80 C A 1: 66,503,776 N396K probably damaging Het
Vmn1r171 T C 7: 23,632,587 L79P probably damaging Het
Vmn2r115 G T 17: 23,347,953 V480F possibly damaging Het
Xpo4 T C 14: 57,586,644 I995V probably null Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33954188 missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33956836 missense probably benign 0.18
IGL01665:Rbp3 APN 14 33956131 missense probably benign 0.02
IGL01809:Rbp3 APN 14 33955300 missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33958645 missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33955719 missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33954503 missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33958583 missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33954659 missense probably damaging 0.97
Behagt UTSW 14 33954454 missense probably benign 0.00
jagt UTSW 14 33956482 missense probably damaging 0.97
muntre UTSW 14 33956356 missense possibly damaging 0.95
Rotwild UTSW 14 33956018 missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33955499 missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33954773 missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33962419 missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33958648 missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33958647 missense probably benign 0.28
R0747:Rbp3 UTSW 14 33956278 missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33956638 missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33956356 missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33954524 missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33955792 missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33956198 missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33956909 missense probably benign 0.38
R1830:Rbp3 UTSW 14 33954644 missense probably benign 0.31
R1982:Rbp3 UTSW 14 33954545 missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R1985:Rbp3 UTSW 14 33956461 missense probably benign 0.00
R2027:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33956057 missense probably benign 0.00
R2138:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33962563 missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33954454 missense probably benign 0.00
R3111:Rbp3 UTSW 14 33954112 missense probably benign 0.01
R3155:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33955507 missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33955390 missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4277:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4278:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4382:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4383:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4385:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4625:Rbp3 UTSW 14 33956099 missense probably benign
R4712:Rbp3 UTSW 14 33960658 missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33954774 missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33955411 missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33954470 missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33954850 missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33956413 missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33956627 missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R5994:Rbp3 UTSW 14 33954900 missense probably damaging 1.00
R6010:Rbp3 UTSW 14 33954647 missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33956482 missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33954461 missense probably benign
R6357:Rbp3 UTSW 14 33957034 missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33955267 nonsense probably null
R6777:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R7158:Rbp3 UTSW 14 33955556 missense probably benign 0.00
R7183:Rbp3 UTSW 14 33955204 missense probably benign 0.02
R7256:Rbp3 UTSW 14 33962583 missense possibly damaging 0.93
R7654:Rbp3 UTSW 14 33955840 missense probably benign
R7756:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7758:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7784:Rbp3 UTSW 14 33954158 missense probably benign 0.41
R7845:Rbp3 UTSW 14 33956464 missense probably benign 0.24
R8176:Rbp3 UTSW 14 33955648 missense possibly damaging 0.67
R8281:Rbp3 UTSW 14 33956363 missense probably benign 0.00
R8393:Rbp3 UTSW 14 33956199 missense possibly damaging 0.93
Z1177:Rbp3 UTSW 14 33954538 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTACTAGCCACAGGACTGCCAC -3'
(R):5'- TCCCCAGGGCTATGGAATAC -3'

Sequencing Primer
(F):5'- GAAGAGTTTGCCTTCCTCATGCAG -3'
(R):5'- TGGAATACCAGCAGGCGGTG -3'
Posted On2014-08-25