Mutagenetix > Incidental Mutation

Incidental Mutation 'R1987:Nfasc'

222588

Institutional Source

Beutler Lab

Gene Symbol

Nfasc

Ensembl Gene

ENSMUSG00000026442

Gene Name

neurofascin

Synonyms

D430023G06Rik

MMRRC Submission

039999-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1987 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

132564690-132741797 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 132610886 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 427 (D427G)

Ref Sequence

ENSEMBL: ENSMUSP00000139955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043189] [ENSMUST00000094569] [ENSMUST00000163770] [ENSMUST00000187861] [ENSMUST00000188307]

AlphaFold

Q810U3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043189
AA Change: D421G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000035454
Gene: ENSMUSG00000026442
AA Change: D421G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	42	131	4.5e0	SMART
IG	141	228	2.44e-7	SMART
IGc2	253	317	1.53e-17	SMART
IGc2	343	409	1.76e-8	SMART
IGc2	437	502	2.39e-10	SMART
IGc2	528	593	2.54e-5	SMART
FN3	607	690	2.17e-11	SMART
FN3	707	789	2.85e-6	SMART
FN3	805	896	2.21e-3	SMART
FN3	911	995	9.92e-6	SMART
low complexity region	996	1018	N/A	INTRINSIC
transmembrane domain	1026	1048	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1049	1133	1.4e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000094569
AA Change: D427G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092148
Gene: ENSMUSG00000026442
AA Change: D427G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	48	137	4.5e0	SMART
IG	147	234	2.44e-7	SMART
IGc2	259	323	1.53e-17	SMART
IGc2	349	415	1.76e-8	SMART
IGc2	443	508	2.39e-10	SMART
IGc2	534	599	2.54e-5	SMART
FN3	628	711	2.17e-11	SMART
FN3	728	810	2.85e-6	SMART
FN3	825	909	9.92e-6	SMART
FN3	1010	1086	6.91e-5	SMART
transmembrane domain	1109	1131	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1132	1216	2.2e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163770
AA Change: D438G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132979
Gene: ENSMUSG00000026442
AA Change: D438G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	42	131	4.5e0	SMART
IG	141	228	2.44e-7	SMART
IGc2	270	334	1.53e-17	SMART
IGc2	360	426	1.76e-8	SMART
IGc2	454	519	2.39e-10	SMART
IGc2	545	610	2.54e-5	SMART
FN3	624	707	2.17e-11	SMART
FN3	724	806	2.85e-6	SMART
FN3	822	913	2.21e-3	SMART
FN3	928	1012	9.92e-6	SMART
low complexity region	1013	1035	N/A	INTRINSIC
transmembrane domain	1043	1065	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1066	1150	5e-30	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000186389
AA Change: D407G

Predicted Effect

probably damaging
Transcript: ENSMUST00000187861
AA Change: D427G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139955
Gene: ENSMUSG00000026442
AA Change: D427G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	48	137	1.8e-2	SMART
IG	147	234	1e-9	SMART
IGc2	259	323	6.4e-20	SMART
IGc2	349	415	7e-11	SMART
IGc2	443	508	9.7e-13	SMART
IGc2	534	599	1.1e-7	SMART
FN3	628	711	1e-13	SMART
FN3	728	810	1.4e-8	SMART
FN3	826	917	1.1e-5	SMART
FN3	932	1016	4.8e-8	SMART
FN3	1117	1193	3.4e-7	SMART
transmembrane domain	1216	1238	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1239	1325	2.6e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000188307
AA Change: D421G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139520
Gene: ENSMUSG00000026442
AA Change: D421G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	42	131	1.8e-2	SMART
IG	141	228	1e-9	SMART
IGc2	253	317	6.4e-20	SMART
IGc2	343	409	7e-11	SMART
IGc2	437	502	9.7e-13	SMART
IGc2	528	593	1.1e-7	SMART
FN3	622	705	1e-13	SMART
FN3	722	804	1.4e-8	SMART
FN3	820	890	3.8e-1	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele die within 6 to 7 days of birth, exhibit reduced nerve conduction velocity and abnormal paranodal junction formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	T	11: 78,268,167	Q433L	probably damaging	Het
4932438A13Rik	T	A	3: 36,953,985		probably null	Het
Ahnak	A	T	19: 9,015,251	D4633V	probably damaging	Het
Akap6	T	C	12: 53,140,795	F1664S	possibly damaging	Het
Arhgef28	T	C	13: 97,967,096	M803V	probably benign	Het
BC117090	C	A	16: 36,321,832	G61C	probably damaging	Het
Ccdc73	T	A	2: 104,931,045	L130*	probably null	Het
Ccdc73	A	G	2: 104,999,159	E1059G	probably damaging	Het
Ccer2	A	C	7: 28,757,283	S151R	possibly damaging	Het
Cep128	T	A	12: 91,230,829	H406L	probably benign	Het
Cep135	A	G	5: 76,597,428	D229G	probably benign	Het
Cpvl	T	A	6: 53,954,611	D103V	probably benign	Het
Disp3	G	A	4: 148,258,753	A567V	probably damaging	Het
Dnah5	T	C	15: 28,343,591	I2379T	probably damaging	Het
Dnah6	T	C	6: 73,095,044	Y2433C	probably damaging	Het
Dock3	A	G	9: 107,108,421	I85T	probably benign	Het
Dock9	A	C	14: 121,591,830	S1380A	probably benign	Het
Erbin	T	C	13: 103,886,203	T43A	probably benign	Het
Fastkd3	T	C	13: 68,585,241	V502A	possibly damaging	Het
Fn1	T	C	1: 71,651,625	H59R	probably damaging	Het
Fsd2	A	G	7: 81,559,659	V145A	possibly damaging	Het
Fzr1	A	G	10: 81,370,319	V178A	probably damaging	Het
Gnpnat1	T	C	14: 45,380,998	R116G	probably damaging	Het
Grm7	T	A	6: 110,914,511	V235E	probably damaging	Het
Hdac4	A	C	1: 91,934,645	N1002K	probably damaging	Het
Hey1	C	T	3: 8,664,897	A167T	probably benign	Het
Hrnr	A	G	3: 93,332,604	N3383S	unknown	Het
Ints2	A	T	11: 86,217,800	V907D	probably benign	Het
Ispd	T	A	12: 36,521,996	L301Q	probably damaging	Het
Jchain	T	A	5: 88,521,467	Q109L	probably damaging	Het
Klhdc7a	A	T	4: 139,966,024	Y537*	probably null	Het
Klra1	C	T	6: 130,377,779	S92N	probably benign	Het
Krt31	C	T	11: 100,049,580	G150S	probably benign	Het
Lrrc71	G	A	3: 87,742,643	T326M	probably benign	Het
Lrrn4	T	C	2: 132,870,443	T487A	probably benign	Het
Map4k5	T	G	12: 69,842,912	R198S	probably damaging	Het
Men1	G	A	19: 6,338,837	C354Y	probably damaging	Het
Ms4a18	A	T	19: 11,013,655	V25E	probably damaging	Het
Mutyh	T	A	4: 116,819,368	S512R	possibly damaging	Het
Myh10	G	T	11: 68,814,496	A1947S	possibly damaging	Het
Nlrp9c	A	G	7: 26,378,056	M767T	probably benign	Het
Nrbp1	T	C	5: 31,245,391	L185P	probably damaging	Het
Pcdh9	G	A	14: 93,888,305	P143L	probably damaging	Het
Pcsk6	A	T	7: 65,927,287	M158L	possibly damaging	Het
Pkd1	G	T	17: 24,576,592		probably null	Het
Plk4	A	T	3: 40,805,817	S383C	possibly damaging	Het
Plxna2	T	C	1: 194,643,989	L77P	probably damaging	Het
Pnpla6	A	T	8: 3,542,370	T1209S	probably benign	Het
Prdm2	A	G	4: 143,132,509	S1404P	possibly damaging	Het
Preb	T	C	5: 30,958,813	D150G	probably damaging	Het
Prrt2	A	G	7: 127,018,730	V59A	probably benign	Het
Prss40	T	C	1: 34,558,014	N151S	possibly damaging	Het
Ptprt	G	T	2: 161,558,898	A1053D	probably damaging	Het
Ptprt	A	G	2: 161,766,321	V685A	possibly damaging	Het
Rfx4	C	T	10: 84,896,088	S549F	possibly damaging	Het
Rnaset2b	T	A	17: 6,996,477	V87E	probably benign	Het
Rnf213	G	A	11: 119,441,107	E2381K	probably damaging	Het
Sectm1a	A	T	11: 121,069,680	I103N	probably damaging	Het
Selp	T	A	1: 164,142,758	L597Q	probably damaging	Het
Sema6a	T	C	18: 47,300,142	D74G	probably damaging	Het
Serpinb9b	T	C	13: 33,029,559	V33A	probably benign	Het
Setd1b	A	T	5: 123,147,706	T272S	unknown	Het
Sgf29	G	C	7: 126,649,477		probably null	Het
Slc4a10	C	A	2: 62,268,204	Q561K	probably damaging	Het
Slc4a5	T	C	6: 83,273,232	I649T	possibly damaging	Het
Slc5a7	A	G	17: 54,293,835	Y91H	probably damaging	Het
Styxl1	T	C	5: 135,757,122	Y23C	probably damaging	Het
Tbc1d24	A	G	17: 24,206,872	V490A	possibly damaging	Het
Tbpl2	A	T	2: 24,094,732	F133L	probably benign	Het
Tcrg-C3	C	A	13: 19,260,994	F37L	probably damaging	Het
Tnfrsf22	T	C	7: 143,638,389		probably benign	Het
Top2b	A	G	14: 16,398,916	E512G	probably damaging	Het
Ttc17	T	A	2: 94,364,345	H561L	probably benign	Het
Ttll4	G	T	1: 74,685,368	V566L	possibly damaging	Het
Ubqlnl	A	G	7: 104,148,485	Y602H	probably benign	Het
Vmn1r231	T	A	17: 20,889,950	E234D	probably damaging	Het
Wbp11	A	G	6: 136,820,585	S279P	probably damaging	Het
Wdr6	A	G	9: 108,576,534	L50P	probably damaging	Het
Zfp715	A	C	7: 43,298,649	I629S	possibly damaging	Het

Other mutations in Nfasc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Nfasc	APN	1	132573798	nonsense	probably null
IGL01088:Nfasc	APN	1	132642776	utr 5 prime	probably benign
IGL01958:Nfasc	APN	1	132608438	nonsense	probably null
IGL01999:Nfasc	APN	1	132605247	splice site	probably benign
IGL02170:Nfasc	APN	1	132610366	nonsense	probably null
IGL02187:Nfasc	APN	1	132570481	missense	probably damaging	1.00
IGL02192:Nfasc	APN	1	132570481	missense	probably damaging	1.00
IGL02452:Nfasc	APN	1	132620924	critical splice donor site	probably null
IGL02698:Nfasc	APN	1	132634737	missense	probably benign	0.06
IGL02797:Nfasc	APN	1	132610448	missense	probably damaging	1.00
IGL03000:Nfasc	APN	1	132621509	splice site	probably benign
IGL03027:Nfasc	APN	1	132610469	missense	probably damaging	1.00
Fascist	UTSW	1	132611605	missense	probably damaging	1.00
jiggle	UTSW	1	132602021	missense	probably damaging	1.00
Partisan	UTSW	1	132605549	missense	probably damaging	1.00
Tremble	UTSW	1	132611595	missense	probably damaging	1.00
PIT4377001:Nfasc	UTSW	1	132583066	missense	unknown
R0240:Nfasc	UTSW	1	132601983	missense	probably damaging	1.00
R0240:Nfasc	UTSW	1	132601983	missense	probably damaging	1.00
R0241:Nfasc	UTSW	1	132636993	missense	probably benign	0.02
R0241:Nfasc	UTSW	1	132636993	missense	probably benign	0.02
R0418:Nfasc	UTSW	1	132611595	missense	probably damaging	1.00
R0513:Nfasc	UTSW	1	132603846	missense	possibly damaging	0.95
R0639:Nfasc	UTSW	1	132603816	missense	probably damaging	1.00
R0646:Nfasc	UTSW	1	132608438	nonsense	probably null
R1103:Nfasc	UTSW	1	132607057	splice site	probably benign
R1269:Nfasc	UTSW	1	132610788	missense	probably damaging	1.00
R1550:Nfasc	UTSW	1	132608503	missense	probably damaging	0.96
R1749:Nfasc	UTSW	1	132611632	missense	probably damaging	1.00
R1773:Nfasc	UTSW	1	132610839	missense	probably damaging	1.00
R1921:Nfasc	UTSW	1	132610805	missense	probably damaging	1.00
R2141:Nfasc	UTSW	1	132596645	missense	probably damaging	1.00
R2239:Nfasc	UTSW	1	132583022	intron	probably benign
R2413:Nfasc	UTSW	1	132595505	missense	probably damaging	1.00
R2428:Nfasc	UTSW	1	132595654	missense	possibly damaging	0.55
R2472:Nfasc	UTSW	1	132588221	intron	probably benign
R2517:Nfasc	UTSW	1	132597763	splice site	probably null
R3850:Nfasc	UTSW	1	132631733	missense	probably damaging	1.00
R4050:Nfasc	UTSW	1	132610305	splice site	probably benign
R4061:Nfasc	UTSW	1	132597845	missense	probably damaging	1.00
R4088:Nfasc	UTSW	1	132595591	missense	probably damaging	1.00
R4342:Nfasc	UTSW	1	132631705	missense	probably damaging	1.00
R4343:Nfasc	UTSW	1	132631705	missense	probably damaging	1.00
R4345:Nfasc	UTSW	1	132631705	missense	probably damaging	1.00
R4452:Nfasc	UTSW	1	132634671	missense	probably damaging	1.00
R4818:Nfasc	UTSW	1	132603830	missense	possibly damaging	0.87
R4851:Nfasc	UTSW	1	132602021	missense	probably damaging	1.00
R5014:Nfasc	UTSW	1	132584447	intron	probably benign
R5768:Nfasc	UTSW	1	132605145	missense	probably benign	0.00
R6145:Nfasc	UTSW	1	132634717	missense	probably damaging	1.00
R6335:Nfasc	UTSW	1	132576394	missense	probably damaging	0.98
R6379:Nfasc	UTSW	1	132570542	nonsense	probably null
R6486:Nfasc	UTSW	1	132605214	missense	probably damaging	1.00
R7022:Nfasc	UTSW	1	132621049	missense	probably damaging	1.00
R7062:Nfasc	UTSW	1	132601969	critical splice donor site	probably null
R7084:Nfasc	UTSW	1	132570509	missense	unknown
R7275:Nfasc	UTSW	1	132634263	missense	probably damaging	1.00
R7286:Nfasc	UTSW	1	132602052	missense	probably damaging	1.00
R7682:Nfasc	UTSW	1	132573773	missense	unknown
R7838:Nfasc	UTSW	1	132605549	missense	probably damaging	1.00
R7871:Nfasc	UTSW	1	132600013	missense	not run
R7938:Nfasc	UTSW	1	132605531	missense	probably damaging	1.00
R8083:Nfasc	UTSW	1	132596582	missense	probably benign	0.00
R8482:Nfasc	UTSW	1	132605089	missense	probably damaging	1.00
R9027:Nfasc	UTSW	1	132611605	missense	probably damaging	1.00
R9164:Nfasc	UTSW	1	132634806	missense	probably damaging	1.00
R9488:Nfasc	UTSW	1	132600128	missense	possibly damaging	0.68
R9651:Nfasc	UTSW	1	132600053	missense	probably benign	0.04
Z1176:Nfasc	UTSW	1	132634638	missense	probably benign	0.00
Z1177:Nfasc	UTSW	1	132631838	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGATGGCCAGCTTTGACTG -3'
(R):5'- GAATCCCAGAGACTGTAGGC -3'

Sequencing Primer
(F):5'- CTTTGACTGTTTAAAGAGCCCAGGC -3'
(R):5'- TCCCAGAGACTGTAGGCTGGATC -3'

Posted On

2014-08-25