Incidental Mutation 'R1987:Ttc17'
ID 222599
Institutional Source Beutler Lab
Gene Symbol Ttc17
Ensembl Gene ENSMUSG00000027194
Gene Name tetratricopeptide repeat domain 17
Synonyms D2Bwg1005e, 9130020K17Rik
MMRRC Submission 039999-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.556) question?
Stock # R1987 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 94131112-94237034 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 94194690 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 561 (H561L)
Ref Sequence ENSEMBL: ENSMUSP00000106869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055081] [ENSMUST00000094801] [ENSMUST00000111237] [ENSMUST00000111238]
AlphaFold E9PVB5
Predicted Effect probably benign
Transcript: ENSMUST00000055081
SMART Domains Protein: ENSMUSP00000061360
Gene: ENSMUSG00000027194

DomainStartEndE-ValueType
TPR 46 79 1.33e1 SMART
Blast:TPR 82 115 3e-10 BLAST
TPR 116 149 4.91e-4 SMART
low complexity region 326 344 N/A INTRINSIC
TPR 499 532 2.43e1 SMART
TPR 535 568 6.75e1 SMART
TPR 569 602 6.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094801
AA Change: H561L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092395
Gene: ENSMUSG00000027194
AA Change: H561L

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
internal_repeat_1 113 271 7.26e-16 PROSPERO
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
coiled coil region 340 382 N/A INTRINSIC
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 3e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 899 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111237
AA Change: H561L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106868
Gene: ENSMUSG00000027194
AA Change: H561L

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
Blast:TPR 225 258 8e-11 BLAST
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 4e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 842 860 N/A INTRINSIC
TPR 1015 1048 2.43e1 SMART
TPR 1051 1084 6.75e1 SMART
TPR 1085 1118 6.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111238
AA Change: H561L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106869
Gene: ENSMUSG00000027194
AA Change: H561L

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
internal_repeat_2 113 271 8.31e-15 PROSPERO
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
coiled coil region 340 382 N/A INTRINSIC
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 4e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 899 917 N/A INTRINSIC
TPR 1072 1105 2.43e1 SMART
TPR 1108 1141 6.75e1 SMART
TPR 1142 1175 6.84e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150215
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 8,992,615 (GRCm39) D4633V probably damaging Het
Akap6 T C 12: 53,187,578 (GRCm39) F1664S possibly damaging Het
Arhgef28 T C 13: 98,103,604 (GRCm39) M803V probably benign Het
Bltp1 T A 3: 37,008,134 (GRCm39) probably null Het
Bltp2 A T 11: 78,158,993 (GRCm39) Q433L probably damaging Het
Ccdc73 T A 2: 104,761,390 (GRCm39) L130* probably null Het
Ccdc73 A G 2: 104,829,504 (GRCm39) E1059G probably damaging Het
Ccer2 A C 7: 28,456,708 (GRCm39) S151R possibly damaging Het
Cep128 T A 12: 91,197,603 (GRCm39) H406L probably benign Het
Cep135 A G 5: 76,745,275 (GRCm39) D229G probably benign Het
Cpvl T A 6: 53,931,596 (GRCm39) D103V probably benign Het
Crppa T A 12: 36,571,995 (GRCm39) L301Q probably damaging Het
Cstdc6 C A 16: 36,142,194 (GRCm39) G61C probably damaging Het
Disp3 G A 4: 148,343,210 (GRCm39) A567V probably damaging Het
Dnah5 T C 15: 28,343,737 (GRCm39) I2379T probably damaging Het
Dnah6 T C 6: 73,072,027 (GRCm39) Y2433C probably damaging Het
Dock3 A G 9: 106,985,620 (GRCm39) I85T probably benign Het
Dock9 A C 14: 121,829,242 (GRCm39) S1380A probably benign Het
Erbin T C 13: 104,022,711 (GRCm39) T43A probably benign Het
Fastkd3 T C 13: 68,733,360 (GRCm39) V502A possibly damaging Het
Fn1 T C 1: 71,690,784 (GRCm39) H59R probably damaging Het
Fsd2 A G 7: 81,209,407 (GRCm39) V145A possibly damaging Het
Fzr1 A G 10: 81,206,153 (GRCm39) V178A probably damaging Het
Gnpnat1 T C 14: 45,618,455 (GRCm39) R116G probably damaging Het
Grm7 T A 6: 110,891,472 (GRCm39) V235E probably damaging Het
Hdac4 A C 1: 91,862,367 (GRCm39) N1002K probably damaging Het
Hey1 C T 3: 8,729,957 (GRCm39) A167T probably benign Het
Hrnr A G 3: 93,239,911 (GRCm39) N3383S unknown Het
Ints2 A T 11: 86,108,626 (GRCm39) V907D probably benign Het
Jchain T A 5: 88,669,326 (GRCm39) Q109L probably damaging Het
Klhdc7a A T 4: 139,693,335 (GRCm39) Y537* probably null Het
Klra1 C T 6: 130,354,742 (GRCm39) S92N probably benign Het
Krt31 C T 11: 99,940,406 (GRCm39) G150S probably benign Het
Lrrc71 G A 3: 87,649,950 (GRCm39) T326M probably benign Het
Lrrn4 T C 2: 132,712,363 (GRCm39) T487A probably benign Het
Map4k5 T G 12: 69,889,686 (GRCm39) R198S probably damaging Het
Men1 G A 19: 6,388,867 (GRCm39) C354Y probably damaging Het
Ms4a18 A T 19: 10,991,019 (GRCm39) V25E probably damaging Het
Mutyh T A 4: 116,676,565 (GRCm39) S512R possibly damaging Het
Myh10 G T 11: 68,705,322 (GRCm39) A1947S possibly damaging Het
Nfasc T C 1: 132,538,624 (GRCm39) D427G probably damaging Het
Nlrp9c A G 7: 26,077,481 (GRCm39) M767T probably benign Het
Nrbp1 T C 5: 31,402,735 (GRCm39) L185P probably damaging Het
Pcdh9 G A 14: 94,125,741 (GRCm39) P143L probably damaging Het
Pcsk6 A T 7: 65,577,035 (GRCm39) M158L possibly damaging Het
Pkd1 G T 17: 24,795,566 (GRCm39) probably null Het
Plk4 A T 3: 40,760,252 (GRCm39) S383C possibly damaging Het
Plxna2 T C 1: 194,326,297 (GRCm39) L77P probably damaging Het
Pnpla6 A T 8: 3,592,370 (GRCm39) T1209S probably benign Het
Prdm2 A G 4: 142,859,079 (GRCm39) S1404P possibly damaging Het
Preb T C 5: 31,116,157 (GRCm39) D150G probably damaging Het
Prrt2 A G 7: 126,617,902 (GRCm39) V59A probably benign Het
Prss40 T C 1: 34,597,095 (GRCm39) N151S possibly damaging Het
Ptprt G T 2: 161,400,818 (GRCm39) A1053D probably damaging Het
Ptprt A G 2: 161,608,241 (GRCm39) V685A possibly damaging Het
Rfx4 C T 10: 84,731,952 (GRCm39) S549F possibly damaging Het
Rnaset2b T A 17: 7,263,876 (GRCm39) V87E probably benign Het
Rnf213 G A 11: 119,331,933 (GRCm39) E2381K probably damaging Het
Sectm1a A T 11: 120,960,506 (GRCm39) I103N probably damaging Het
Selp T A 1: 163,970,327 (GRCm39) L597Q probably damaging Het
Sema6a T C 18: 47,433,209 (GRCm39) D74G probably damaging Het
Serpinb9b T C 13: 33,213,542 (GRCm39) V33A probably benign Het
Setd1b A T 5: 123,285,769 (GRCm39) T272S unknown Het
Sgf29 G C 7: 126,248,649 (GRCm39) probably null Het
Slc4a10 C A 2: 62,098,548 (GRCm39) Q561K probably damaging Het
Slc4a5 T C 6: 83,250,214 (GRCm39) I649T possibly damaging Het
Slc5a7 A G 17: 54,600,863 (GRCm39) Y91H probably damaging Het
Styxl1 T C 5: 135,785,976 (GRCm39) Y23C probably damaging Het
Tbc1d24 A G 17: 24,425,846 (GRCm39) V490A possibly damaging Het
Tbpl2 A T 2: 23,984,744 (GRCm39) F133L probably benign Het
Tnfrsf22 T C 7: 143,192,126 (GRCm39) probably benign Het
Top2b A G 14: 16,398,916 (GRCm38) E512G probably damaging Het
Trgc3 C A 13: 19,445,164 (GRCm39) F37L probably damaging Het
Ttll4 G T 1: 74,724,527 (GRCm39) V566L possibly damaging Het
Ubqlnl A G 7: 103,797,692 (GRCm39) Y602H probably benign Het
Vmn1r231 T A 17: 21,110,212 (GRCm39) E234D probably damaging Het
Wbp11 A G 6: 136,797,583 (GRCm39) S279P probably damaging Het
Wdr6 A G 9: 108,453,733 (GRCm39) L50P probably damaging Het
Zfp715 A C 7: 42,948,073 (GRCm39) I629S possibly damaging Het
Other mutations in Ttc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ttc17 APN 2 94,153,428 (GRCm39) splice site probably benign
IGL00870:Ttc17 APN 2 94,202,078 (GRCm39) splice site probably null
IGL01120:Ttc17 APN 2 94,202,141 (GRCm39) missense probably damaging 1.00
IGL01845:Ttc17 APN 2 94,163,177 (GRCm39) nonsense probably null
IGL01895:Ttc17 APN 2 94,205,491 (GRCm39) missense possibly damaging 0.80
IGL02064:Ttc17 APN 2 94,161,012 (GRCm39) missense probably damaging 1.00
IGL02296:Ttc17 APN 2 94,208,055 (GRCm39) missense probably damaging 1.00
IGL02309:Ttc17 APN 2 94,173,006 (GRCm39) missense probably benign
IGL02456:Ttc17 APN 2 94,193,130 (GRCm39) splice site probably benign
IGL02475:Ttc17 APN 2 94,194,721 (GRCm39) missense probably damaging 1.00
IGL03341:Ttc17 APN 2 94,205,566 (GRCm39) missense probably damaging 1.00
IGL03371:Ttc17 APN 2 94,216,450 (GRCm39) missense probably damaging 1.00
R0389:Ttc17 UTSW 2 94,208,439 (GRCm39) missense probably benign 0.03
R0443:Ttc17 UTSW 2 94,208,439 (GRCm39) missense probably benign 0.03
R0511:Ttc17 UTSW 2 94,153,465 (GRCm39) missense possibly damaging 0.87
R0763:Ttc17 UTSW 2 94,163,148 (GRCm39) missense probably benign 0.08
R1980:Ttc17 UTSW 2 94,157,049 (GRCm39) missense probably benign 0.14
R1981:Ttc17 UTSW 2 94,157,049 (GRCm39) missense probably benign 0.14
R2064:Ttc17 UTSW 2 94,196,892 (GRCm39) missense probably damaging 1.00
R2147:Ttc17 UTSW 2 94,132,139 (GRCm39) missense possibly damaging 0.87
R2155:Ttc17 UTSW 2 94,196,987 (GRCm39) missense possibly damaging 0.88
R2844:Ttc17 UTSW 2 94,206,419 (GRCm39) nonsense probably null
R3719:Ttc17 UTSW 2 94,194,672 (GRCm39) missense probably benign 0.27
R3852:Ttc17 UTSW 2 94,199,758 (GRCm39) missense possibly damaging 0.86
R3947:Ttc17 UTSW 2 94,206,491 (GRCm39) splice site probably benign
R4411:Ttc17 UTSW 2 94,173,098 (GRCm39) missense probably damaging 0.97
R4461:Ttc17 UTSW 2 94,196,916 (GRCm39) missense probably benign 0.02
R4660:Ttc17 UTSW 2 94,194,774 (GRCm39) missense possibly damaging 0.51
R4762:Ttc17 UTSW 2 94,202,113 (GRCm39) missense probably damaging 1.00
R4818:Ttc17 UTSW 2 94,163,236 (GRCm39) missense possibly damaging 0.91
R4819:Ttc17 UTSW 2 94,194,955 (GRCm39) missense probably damaging 1.00
R4864:Ttc17 UTSW 2 94,196,980 (GRCm39) missense probably benign 0.01
R4870:Ttc17 UTSW 2 94,196,954 (GRCm39) missense probably damaging 1.00
R5203:Ttc17 UTSW 2 94,209,061 (GRCm39) missense probably damaging 1.00
R5288:Ttc17 UTSW 2 94,133,985 (GRCm39) missense probably damaging 1.00
R5385:Ttc17 UTSW 2 94,133,985 (GRCm39) missense probably damaging 1.00
R5386:Ttc17 UTSW 2 94,133,985 (GRCm39) missense probably damaging 1.00
R5453:Ttc17 UTSW 2 94,133,905 (GRCm39) missense probably damaging 1.00
R5583:Ttc17 UTSW 2 94,208,027 (GRCm39) missense probably damaging 1.00
R5683:Ttc17 UTSW 2 94,192,866 (GRCm39) missense probably damaging 1.00
R5921:Ttc17 UTSW 2 94,209,193 (GRCm39) missense probably damaging 1.00
R6272:Ttc17 UTSW 2 94,189,100 (GRCm39) missense probably damaging 1.00
R6444:Ttc17 UTSW 2 94,133,891 (GRCm39) missense possibly damaging 0.57
R6748:Ttc17 UTSW 2 94,216,447 (GRCm39) missense probably benign 0.02
R7204:Ttc17 UTSW 2 94,192,773 (GRCm39) missense possibly damaging 0.95
R7300:Ttc17 UTSW 2 94,205,479 (GRCm39) missense probably damaging 1.00
R7446:Ttc17 UTSW 2 94,205,495 (GRCm39) missense probably damaging 0.97
R7680:Ttc17 UTSW 2 94,196,889 (GRCm39) missense probably benign 0.06
R7912:Ttc17 UTSW 2 94,209,166 (GRCm39) missense probably damaging 1.00
R8083:Ttc17 UTSW 2 94,204,909 (GRCm39) missense probably damaging 1.00
R8304:Ttc17 UTSW 2 94,199,526 (GRCm39) intron probably benign
R8381:Ttc17 UTSW 2 94,132,166 (GRCm39) missense probably damaging 1.00
R8512:Ttc17 UTSW 2 94,202,108 (GRCm39) missense probably damaging 1.00
R8737:Ttc17 UTSW 2 94,206,374 (GRCm39) critical splice donor site probably null
R8850:Ttc17 UTSW 2 94,237,003 (GRCm39) missense possibly damaging 0.55
R8886:Ttc17 UTSW 2 94,205,473 (GRCm39) missense probably benign 0.19
R8888:Ttc17 UTSW 2 94,157,049 (GRCm39) missense probably benign 0.14
R8891:Ttc17 UTSW 2 94,192,764 (GRCm39) missense probably damaging 1.00
R9336:Ttc17 UTSW 2 94,189,198 (GRCm39) missense probably benign 0.00
R9600:Ttc17 UTSW 2 94,204,890 (GRCm39) missense probably damaging 1.00
R9632:Ttc17 UTSW 2 94,209,097 (GRCm39) missense probably damaging 1.00
R9642:Ttc17 UTSW 2 94,194,735 (GRCm39) missense probably benign 0.00
R9657:Ttc17 UTSW 2 94,237,010 (GRCm39) start codon destroyed probably benign 0.02
X0013:Ttc17 UTSW 2 94,161,015 (GRCm39) missense probably damaging 1.00
X0018:Ttc17 UTSW 2 94,209,061 (GRCm39) missense probably damaging 1.00
X0025:Ttc17 UTSW 2 94,154,861 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGCTTCTCACTGAAAACCTTCCG -3'
(R):5'- AGATGGATGTGGCAGAGCTC -3'

Sequencing Primer
(F):5'- GAAAACCTTCCGTCAAGTTTCTG -3'
(R):5'- GCAGAGCTCCTGATTCTGCATG -3'
Posted On 2014-08-25