Incidental Mutation 'R1987:Ptprt'
ID 222609
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase receptor type T
Synonyms RPTPrho
MMRRC Submission 039999-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R1987 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 161363910-162503067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 161608241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 685 (V685A)
Ref Sequence ENSEMBL: ENSMUSP00000105068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000109441
AA Change: V685A

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: V685A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109442
AA Change: V685A

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: V685A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109443
AA Change: V685A

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: V685A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109445
AA Change: V685A

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: V685A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153770
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 8,992,615 (GRCm39) D4633V probably damaging Het
Akap6 T C 12: 53,187,578 (GRCm39) F1664S possibly damaging Het
Arhgef28 T C 13: 98,103,604 (GRCm39) M803V probably benign Het
Bltp1 T A 3: 37,008,134 (GRCm39) probably null Het
Bltp2 A T 11: 78,158,993 (GRCm39) Q433L probably damaging Het
Ccdc73 T A 2: 104,761,390 (GRCm39) L130* probably null Het
Ccdc73 A G 2: 104,829,504 (GRCm39) E1059G probably damaging Het
Ccer2 A C 7: 28,456,708 (GRCm39) S151R possibly damaging Het
Cep128 T A 12: 91,197,603 (GRCm39) H406L probably benign Het
Cep135 A G 5: 76,745,275 (GRCm39) D229G probably benign Het
Cpvl T A 6: 53,931,596 (GRCm39) D103V probably benign Het
Crppa T A 12: 36,571,995 (GRCm39) L301Q probably damaging Het
Cstdc6 C A 16: 36,142,194 (GRCm39) G61C probably damaging Het
Disp3 G A 4: 148,343,210 (GRCm39) A567V probably damaging Het
Dnah5 T C 15: 28,343,737 (GRCm39) I2379T probably damaging Het
Dnah6 T C 6: 73,072,027 (GRCm39) Y2433C probably damaging Het
Dock3 A G 9: 106,985,620 (GRCm39) I85T probably benign Het
Dock9 A C 14: 121,829,242 (GRCm39) S1380A probably benign Het
Erbin T C 13: 104,022,711 (GRCm39) T43A probably benign Het
Fastkd3 T C 13: 68,733,360 (GRCm39) V502A possibly damaging Het
Fn1 T C 1: 71,690,784 (GRCm39) H59R probably damaging Het
Fsd2 A G 7: 81,209,407 (GRCm39) V145A possibly damaging Het
Fzr1 A G 10: 81,206,153 (GRCm39) V178A probably damaging Het
Gnpnat1 T C 14: 45,618,455 (GRCm39) R116G probably damaging Het
Grm7 T A 6: 110,891,472 (GRCm39) V235E probably damaging Het
Hdac4 A C 1: 91,862,367 (GRCm39) N1002K probably damaging Het
Hey1 C T 3: 8,729,957 (GRCm39) A167T probably benign Het
Hrnr A G 3: 93,239,911 (GRCm39) N3383S unknown Het
Ints2 A T 11: 86,108,626 (GRCm39) V907D probably benign Het
Jchain T A 5: 88,669,326 (GRCm39) Q109L probably damaging Het
Klhdc7a A T 4: 139,693,335 (GRCm39) Y537* probably null Het
Klra1 C T 6: 130,354,742 (GRCm39) S92N probably benign Het
Krt31 C T 11: 99,940,406 (GRCm39) G150S probably benign Het
Lrrc71 G A 3: 87,649,950 (GRCm39) T326M probably benign Het
Lrrn4 T C 2: 132,712,363 (GRCm39) T487A probably benign Het
Map4k5 T G 12: 69,889,686 (GRCm39) R198S probably damaging Het
Men1 G A 19: 6,388,867 (GRCm39) C354Y probably damaging Het
Ms4a18 A T 19: 10,991,019 (GRCm39) V25E probably damaging Het
Mutyh T A 4: 116,676,565 (GRCm39) S512R possibly damaging Het
Myh10 G T 11: 68,705,322 (GRCm39) A1947S possibly damaging Het
Nfasc T C 1: 132,538,624 (GRCm39) D427G probably damaging Het
Nlrp9c A G 7: 26,077,481 (GRCm39) M767T probably benign Het
Nrbp1 T C 5: 31,402,735 (GRCm39) L185P probably damaging Het
Pcdh9 G A 14: 94,125,741 (GRCm39) P143L probably damaging Het
Pcsk6 A T 7: 65,577,035 (GRCm39) M158L possibly damaging Het
Pkd1 G T 17: 24,795,566 (GRCm39) probably null Het
Plk4 A T 3: 40,760,252 (GRCm39) S383C possibly damaging Het
Plxna2 T C 1: 194,326,297 (GRCm39) L77P probably damaging Het
Pnpla6 A T 8: 3,592,370 (GRCm39) T1209S probably benign Het
Prdm2 A G 4: 142,859,079 (GRCm39) S1404P possibly damaging Het
Preb T C 5: 31,116,157 (GRCm39) D150G probably damaging Het
Prrt2 A G 7: 126,617,902 (GRCm39) V59A probably benign Het
Prss40 T C 1: 34,597,095 (GRCm39) N151S possibly damaging Het
Rfx4 C T 10: 84,731,952 (GRCm39) S549F possibly damaging Het
Rnaset2b T A 17: 7,263,876 (GRCm39) V87E probably benign Het
Rnf213 G A 11: 119,331,933 (GRCm39) E2381K probably damaging Het
Sectm1a A T 11: 120,960,506 (GRCm39) I103N probably damaging Het
Selp T A 1: 163,970,327 (GRCm39) L597Q probably damaging Het
Sema6a T C 18: 47,433,209 (GRCm39) D74G probably damaging Het
Serpinb9b T C 13: 33,213,542 (GRCm39) V33A probably benign Het
Setd1b A T 5: 123,285,769 (GRCm39) T272S unknown Het
Sgf29 G C 7: 126,248,649 (GRCm39) probably null Het
Slc4a10 C A 2: 62,098,548 (GRCm39) Q561K probably damaging Het
Slc4a5 T C 6: 83,250,214 (GRCm39) I649T possibly damaging Het
Slc5a7 A G 17: 54,600,863 (GRCm39) Y91H probably damaging Het
Styxl1 T C 5: 135,785,976 (GRCm39) Y23C probably damaging Het
Tbc1d24 A G 17: 24,425,846 (GRCm39) V490A possibly damaging Het
Tbpl2 A T 2: 23,984,744 (GRCm39) F133L probably benign Het
Tnfrsf22 T C 7: 143,192,126 (GRCm39) probably benign Het
Top2b A G 14: 16,398,916 (GRCm38) E512G probably damaging Het
Trgc3 C A 13: 19,445,164 (GRCm39) F37L probably damaging Het
Ttc17 T A 2: 94,194,690 (GRCm39) H561L probably benign Het
Ttll4 G T 1: 74,724,527 (GRCm39) V566L possibly damaging Het
Ubqlnl A G 7: 103,797,692 (GRCm39) Y602H probably benign Het
Vmn1r231 T A 17: 21,110,212 (GRCm39) E234D probably damaging Het
Wbp11 A G 6: 136,797,583 (GRCm39) S279P probably damaging Het
Wdr6 A G 9: 108,453,733 (GRCm39) L50P probably damaging Het
Zfp715 A C 7: 42,948,073 (GRCm39) I629S possibly damaging Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161,652,544 (GRCm39) missense probably benign 0.00
IGL00565:Ptprt APN 2 161,402,111 (GRCm39) missense probably damaging 1.00
IGL00925:Ptprt APN 2 161,498,083 (GRCm39) missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161,393,737 (GRCm39) missense probably damaging 1.00
IGL01432:Ptprt APN 2 162,109,999 (GRCm39) splice site probably benign
IGL02008:Ptprt APN 2 161,769,593 (GRCm39) missense probably benign 0.02
IGL02040:Ptprt APN 2 162,079,992 (GRCm39) missense probably damaging 1.00
IGL02172:Ptprt APN 2 161,397,422 (GRCm39) missense probably damaging 1.00
IGL02231:Ptprt APN 2 162,119,966 (GRCm39) critical splice donor site probably null
IGL02231:Ptprt APN 2 162,079,980 (GRCm39) missense probably damaging 1.00
IGL02232:Ptprt APN 2 161,372,437 (GRCm39) missense probably damaging 0.96
IGL02277:Ptprt APN 2 161,389,301 (GRCm39) missense probably damaging 1.00
IGL02447:Ptprt APN 2 162,120,027 (GRCm39) missense probably benign 0.01
IGL02601:Ptprt APN 2 161,608,227 (GRCm39) missense probably benign 0.10
IGL02623:Ptprt APN 2 161,449,372 (GRCm39) splice site probably benign
IGL03379:Ptprt APN 2 161,397,379 (GRCm39) nonsense probably null
Poverina UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161,375,533 (GRCm39) missense probably damaging 0.96
R0064:Ptprt UTSW 2 161,769,711 (GRCm39) splice site probably benign
R0129:Ptprt UTSW 2 162,119,990 (GRCm39) missense probably benign 0.35
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0132:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0316:Ptprt UTSW 2 161,449,239 (GRCm39) missense probably damaging 1.00
R0454:Ptprt UTSW 2 161,395,742 (GRCm39) missense probably damaging 0.96
R0488:Ptprt UTSW 2 161,395,745 (GRCm39) missense probably damaging 0.99
R0573:Ptprt UTSW 2 161,393,668 (GRCm39) missense probably damaging 1.00
R0614:Ptprt UTSW 2 161,654,040 (GRCm39) missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161,654,059 (GRCm39) splice site probably null
R1023:Ptprt UTSW 2 161,400,863 (GRCm39) missense probably damaging 1.00
R1184:Ptprt UTSW 2 161,769,692 (GRCm39) missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162,120,146 (GRCm39) missense probably damaging 1.00
R1476:Ptprt UTSW 2 161,769,404 (GRCm39) missense probably damaging 1.00
R1515:Ptprt UTSW 2 162,079,954 (GRCm39) missense probably damaging 1.00
R1595:Ptprt UTSW 2 161,652,469 (GRCm39) critical splice donor site probably null
R1939:Ptprt UTSW 2 161,769,560 (GRCm39) missense probably benign 0.45
R1987:Ptprt UTSW 2 161,400,818 (GRCm39) missense probably damaging 1.00
R2049:Ptprt UTSW 2 161,376,465 (GRCm39) missense probably damaging 1.00
R2140:Ptprt UTSW 2 161,653,908 (GRCm39) missense probably damaging 1.00
R2421:Ptprt UTSW 2 162,119,960 (GRCm39) splice site probably benign
R3432:Ptprt UTSW 2 161,769,449 (GRCm39) missense probably damaging 1.00
R3619:Ptprt UTSW 2 161,408,077 (GRCm39) missense probably damaging 1.00
R3757:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3758:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3834:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3835:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3915:Ptprt UTSW 2 161,397,475 (GRCm39) splice site probably benign
R4003:Ptprt UTSW 2 161,408,037 (GRCm39) splice site probably benign
R4387:Ptprt UTSW 2 161,769,570 (GRCm39) missense probably damaging 1.00
R4519:Ptprt UTSW 2 161,406,609 (GRCm39) missense probably damaging 1.00
R4618:Ptprt UTSW 2 161,395,765 (GRCm39) missense probably damaging 1.00
R4677:Ptprt UTSW 2 161,743,366 (GRCm39) critical splice donor site probably null
R4866:Ptprt UTSW 2 161,402,159 (GRCm39) missense probably damaging 1.00
R5088:Ptprt UTSW 2 162,080,095 (GRCm39) missense probably benign 0.01
R5173:Ptprt UTSW 2 161,769,676 (GRCm39) missense probably benign 0.01
R5215:Ptprt UTSW 2 162,120,084 (GRCm39) missense probably damaging 1.00
R5383:Ptprt UTSW 2 161,539,969 (GRCm39) missense probably damaging 1.00
R5398:Ptprt UTSW 2 161,769,512 (GRCm39) missense probably damaging 1.00
R5518:Ptprt UTSW 2 162,120,143 (GRCm39) missense probably damaging 0.99
R5711:Ptprt UTSW 2 161,652,524 (GRCm39) missense probably damaging 0.98
R5735:Ptprt UTSW 2 161,376,484 (GRCm39) missense probably damaging 0.98
R5834:Ptprt UTSW 2 161,402,189 (GRCm39) missense probably damaging 1.00
R5872:Ptprt UTSW 2 161,977,138 (GRCm39) missense probably damaging 1.00
R5926:Ptprt UTSW 2 161,406,606 (GRCm39) missense probably benign 0.00
R6210:Ptprt UTSW 2 162,109,949 (GRCm39) missense probably damaging 1.00
R6285:Ptprt UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161,395,779 (GRCm39) missense probably damaging 1.00
R6406:Ptprt UTSW 2 161,395,703 (GRCm39) missense probably damaging 0.98
R6499:Ptprt UTSW 2 161,376,507 (GRCm39) missense probably benign 0.32
R6613:Ptprt UTSW 2 161,372,367 (GRCm39) missense probably damaging 1.00
R6622:Ptprt UTSW 2 161,395,760 (GRCm39) missense probably damaging 1.00
R7218:Ptprt UTSW 2 161,389,284 (GRCm39) missense probably damaging 1.00
R7247:Ptprt UTSW 2 161,375,443 (GRCm39) missense probably benign 0.15
R7576:Ptprt UTSW 2 161,449,225 (GRCm39) missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161,417,707 (GRCm39) missense probably damaging 1.00
R7735:Ptprt UTSW 2 161,417,661 (GRCm39) missense probably damaging 1.00
R7813:Ptprt UTSW 2 161,372,413 (GRCm39) missense probably damaging 1.00
R8031:Ptprt UTSW 2 161,977,377 (GRCm39) missense probably damaging 1.00
R8074:Ptprt UTSW 2 161,769,581 (GRCm39) missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162,120,005 (GRCm39) missense probably damaging 1.00
R8236:Ptprt UTSW 2 161,528,988 (GRCm39) critical splice donor site probably null
R8308:Ptprt UTSW 2 161,769,566 (GRCm39) missense probably benign 0.00
R8348:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8362:Ptprt UTSW 2 161,393,667 (GRCm39) missense probably damaging 1.00
R8365:Ptprt UTSW 2 161,743,451 (GRCm39) missense probably benign 0.05
R8448:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8512:Ptprt UTSW 2 161,400,783 (GRCm39) missense probably benign 0.00
R8715:Ptprt UTSW 2 161,372,463 (GRCm39) missense probably damaging 1.00
R9004:Ptprt UTSW 2 161,608,314 (GRCm39) missense probably benign 0.04
R9046:Ptprt UTSW 2 161,372,361 (GRCm39) missense possibly damaging 0.58
R9222:Ptprt UTSW 2 161,402,106 (GRCm39) missense probably damaging 1.00
R9297:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9318:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9476:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9510:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9571:Ptprt UTSW 2 161,395,732 (GRCm39) missense probably benign 0.10
X0064:Ptprt UTSW 2 161,769,403 (GRCm39) missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162,080,041 (GRCm39) missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 162,204,868 (GRCm39) missense possibly damaging 0.77
Z1177:Ptprt UTSW 2 161,574,807 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGCTCATGGACCTCAG -3'
(R):5'- ACACAGAGTGACTCATCTGCC -3'

Sequencing Primer
(F):5'- GGCTCATGGACCTCAGTTTATAAAAC -3'
(R):5'- GTCCAGTGTTTACCAGCTGG -3'
Posted On 2014-08-25