Incidental Mutation 'R1987:Lrrc71'
ID 222617
Institutional Source Beutler Lab
Gene Symbol Lrrc71
Ensembl Gene ENSMUSG00000023084
Gene Name leucine rich repeat containing 71
Synonyms
MMRRC Submission 039999-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1987 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 87736923-87748625 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 87742643 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 326 (T326M)
Ref Sequence ENSEMBL: ENSMUSP00000023846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023846] [ENSMUST00000039476] [ENSMUST00000152006]
AlphaFold Q9D3W5
Predicted Effect probably benign
Transcript: ENSMUST00000023846
AA Change: T326M

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023846
Gene: ENSMUSG00000023084
AA Change: T326M

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:LRR 165 191 6e-7 BLAST
LRR 219 246 4.24e-1 SMART
LRR 251 278 1.33e-1 SMART
LRR 279 306 1.98e-4 SMART
low complexity region 312 323 N/A INTRINSIC
low complexity region 329 337 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 407 414 N/A INTRINSIC
LRR 472 499 1.83e2 SMART
low complexity region 547 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039476
SMART Domains Protein: ENSMUSP00000039900
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
RhoGEF 768 952 1.11e-65 SMART
PH 996 1111 9.49e-6 SMART
low complexity region 1153 1166 N/A INTRINSIC
low complexity region 1176 1188 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1357 1367 N/A INTRINSIC
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152006
SMART Domains Protein: ENSMUSP00000122166
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174381
Predicted Effect probably benign
Transcript: ENSMUST00000174581
SMART Domains Protein: ENSMUSP00000134711
Gene: ENSMUSG00000023084

DomainStartEndE-ValueType
Blast:LRR 67 94 1e-10 BLAST
low complexity region 142 152 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A T 11: 78,268,167 (GRCm38) Q433L probably damaging Het
4932438A13Rik T A 3: 36,953,985 (GRCm38) probably null Het
Ahnak A T 19: 9,015,251 (GRCm38) D4633V probably damaging Het
Akap6 T C 12: 53,140,795 (GRCm38) F1664S possibly damaging Het
Arhgef28 T C 13: 97,967,096 (GRCm38) M803V probably benign Het
BC117090 C A 16: 36,321,832 (GRCm38) G61C probably damaging Het
Ccdc73 T A 2: 104,931,045 (GRCm38) L130* probably null Het
Ccdc73 A G 2: 104,999,159 (GRCm38) E1059G probably damaging Het
Ccer2 A C 7: 28,757,283 (GRCm38) S151R possibly damaging Het
Cep128 T A 12: 91,230,829 (GRCm38) H406L probably benign Het
Cep135 A G 5: 76,597,428 (GRCm38) D229G probably benign Het
Cpvl T A 6: 53,954,611 (GRCm38) D103V probably benign Het
Disp3 G A 4: 148,258,753 (GRCm38) A567V probably damaging Het
Dnah5 T C 15: 28,343,591 (GRCm38) I2379T probably damaging Het
Dnah6 T C 6: 73,095,044 (GRCm38) Y2433C probably damaging Het
Dock3 A G 9: 107,108,421 (GRCm38) I85T probably benign Het
Dock9 A C 14: 121,591,830 (GRCm38) S1380A probably benign Het
Erbin T C 13: 103,886,203 (GRCm38) T43A probably benign Het
Fastkd3 T C 13: 68,585,241 (GRCm38) V502A possibly damaging Het
Fn1 T C 1: 71,651,625 (GRCm38) H59R probably damaging Het
Fsd2 A G 7: 81,559,659 (GRCm38) V145A possibly damaging Het
Fzr1 A G 10: 81,370,319 (GRCm38) V178A probably damaging Het
Gnpnat1 T C 14: 45,380,998 (GRCm38) R116G probably damaging Het
Grm7 T A 6: 110,914,511 (GRCm38) V235E probably damaging Het
Hdac4 A C 1: 91,934,645 (GRCm38) N1002K probably damaging Het
Hey1 C T 3: 8,664,897 (GRCm38) A167T probably benign Het
Hrnr A G 3: 93,332,604 (GRCm38) N3383S unknown Het
Ints2 A T 11: 86,217,800 (GRCm38) V907D probably benign Het
Ispd T A 12: 36,521,996 (GRCm38) L301Q probably damaging Het
Jchain T A 5: 88,521,467 (GRCm38) Q109L probably damaging Het
Klhdc7a A T 4: 139,966,024 (GRCm38) Y537* probably null Het
Klra1 C T 6: 130,377,779 (GRCm38) S92N probably benign Het
Krt31 C T 11: 100,049,580 (GRCm38) G150S probably benign Het
Lrrn4 T C 2: 132,870,443 (GRCm38) T487A probably benign Het
Map4k5 T G 12: 69,842,912 (GRCm38) R198S probably damaging Het
Men1 G A 19: 6,338,837 (GRCm38) C354Y probably damaging Het
Ms4a18 A T 19: 11,013,655 (GRCm38) V25E probably damaging Het
Mutyh T A 4: 116,819,368 (GRCm38) S512R possibly damaging Het
Myh10 G T 11: 68,814,496 (GRCm38) A1947S possibly damaging Het
Nfasc T C 1: 132,610,886 (GRCm38) D427G probably damaging Het
Nlrp9c A G 7: 26,378,056 (GRCm38) M767T probably benign Het
Nrbp1 T C 5: 31,245,391 (GRCm38) L185P probably damaging Het
Pcdh9 G A 14: 93,888,305 (GRCm38) P143L probably damaging Het
Pcsk6 A T 7: 65,927,287 (GRCm38) M158L possibly damaging Het
Pkd1 G T 17: 24,576,592 (GRCm38) probably null Het
Plk4 A T 3: 40,805,817 (GRCm38) S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 (GRCm38) L77P probably damaging Het
Pnpla6 A T 8: 3,542,370 (GRCm38) T1209S probably benign Het
Prdm2 A G 4: 143,132,509 (GRCm38) S1404P possibly damaging Het
Preb T C 5: 30,958,813 (GRCm38) D150G probably damaging Het
Prrt2 A G 7: 127,018,730 (GRCm38) V59A probably benign Het
Prss40 T C 1: 34,558,014 (GRCm38) N151S possibly damaging Het
Ptprt G T 2: 161,558,898 (GRCm38) A1053D probably damaging Het
Ptprt A G 2: 161,766,321 (GRCm38) V685A possibly damaging Het
Rfx4 C T 10: 84,896,088 (GRCm38) S549F possibly damaging Het
Rnaset2b T A 17: 6,996,477 (GRCm38) V87E probably benign Het
Rnf213 G A 11: 119,441,107 (GRCm38) E2381K probably damaging Het
Sectm1a A T 11: 121,069,680 (GRCm38) I103N probably damaging Het
Selp T A 1: 164,142,758 (GRCm38) L597Q probably damaging Het
Sema6a T C 18: 47,300,142 (GRCm38) D74G probably damaging Het
Serpinb9b T C 13: 33,029,559 (GRCm38) V33A probably benign Het
Setd1b A T 5: 123,147,706 (GRCm38) T272S unknown Het
Sgf29 G C 7: 126,649,477 (GRCm38) probably null Het
Slc4a10 C A 2: 62,268,204 (GRCm38) Q561K probably damaging Het
Slc4a5 T C 6: 83,273,232 (GRCm38) I649T possibly damaging Het
Slc5a7 A G 17: 54,293,835 (GRCm38) Y91H probably damaging Het
Styxl1 T C 5: 135,757,122 (GRCm38) Y23C probably damaging Het
Tbc1d24 A G 17: 24,206,872 (GRCm38) V490A possibly damaging Het
Tbpl2 A T 2: 24,094,732 (GRCm38) F133L probably benign Het
Tcrg-C3 C A 13: 19,260,994 (GRCm38) F37L probably damaging Het
Tnfrsf22 T C 7: 143,638,389 (GRCm38) probably benign Het
Top2b A G 14: 16,398,916 (GRCm38) E512G probably damaging Het
Ttc17 T A 2: 94,364,345 (GRCm38) H561L probably benign Het
Ttll4 G T 1: 74,685,368 (GRCm38) V566L possibly damaging Het
Ubqlnl A G 7: 104,148,485 (GRCm38) Y602H probably benign Het
Vmn1r231 T A 17: 20,889,950 (GRCm38) E234D probably damaging Het
Wbp11 A G 6: 136,820,585 (GRCm38) S279P probably damaging Het
Wdr6 A G 9: 108,576,534 (GRCm38) L50P probably damaging Het
Zfp715 A C 7: 43,298,649 (GRCm38) I629S possibly damaging Het
Other mutations in Lrrc71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Lrrc71 APN 3 87,745,224 (GRCm38) splice site probably null
IGL02387:Lrrc71 APN 3 87,743,071 (GRCm38) missense probably damaging 0.96
IGL02632:Lrrc71 APN 3 87,743,340 (GRCm38) missense probably damaging 1.00
IGL02701:Lrrc71 APN 3 87,741,772 (GRCm38) missense probably benign 0.37
R0372:Lrrc71 UTSW 3 87,745,777 (GRCm38) missense probably benign 0.40
R0505:Lrrc71 UTSW 3 87,745,699 (GRCm38) missense probably damaging 0.98
R0827:Lrrc71 UTSW 3 87,742,645 (GRCm38) splice site probably null
R1511:Lrrc71 UTSW 3 87,745,484 (GRCm38) missense probably benign 0.00
R1541:Lrrc71 UTSW 3 87,741,841 (GRCm38) missense possibly damaging 0.87
R2054:Lrrc71 UTSW 3 87,742,673 (GRCm38) missense probably damaging 1.00
R2143:Lrrc71 UTSW 3 87,745,521 (GRCm38) nonsense probably null
R2427:Lrrc71 UTSW 3 87,746,002 (GRCm38) missense probably benign
R3700:Lrrc71 UTSW 3 87,745,878 (GRCm38) splice site probably null
R4073:Lrrc71 UTSW 3 87,745,262 (GRCm38) missense probably benign 0.01
R4231:Lrrc71 UTSW 3 87,740,991 (GRCm38) missense probably benign 0.01
R4431:Lrrc71 UTSW 3 87,742,836 (GRCm38) missense possibly damaging 0.59
R4477:Lrrc71 UTSW 3 87,742,665 (GRCm38) missense probably damaging 0.99
R4562:Lrrc71 UTSW 3 87,745,408 (GRCm38) unclassified probably benign
R4563:Lrrc71 UTSW 3 87,745,408 (GRCm38) unclassified probably benign
R4564:Lrrc71 UTSW 3 87,745,408 (GRCm38) unclassified probably benign
R4724:Lrrc71 UTSW 3 87,739,174 (GRCm38) missense probably damaging 0.97
R4826:Lrrc71 UTSW 3 87,743,308 (GRCm38) missense probably benign 0.33
R5156:Lrrc71 UTSW 3 87,745,787 (GRCm38) missense probably benign 0.07
R5631:Lrrc71 UTSW 3 87,739,149 (GRCm38) missense probably benign 0.00
R6182:Lrrc71 UTSW 3 87,745,794 (GRCm38) missense probably benign 0.41
R6558:Lrrc71 UTSW 3 87,742,643 (GRCm38) missense probably benign 0.25
R6885:Lrrc71 UTSW 3 87,742,620 (GRCm38) splice site probably null
R7036:Lrrc71 UTSW 3 87,748,386 (GRCm38) missense probably benign 0.00
R7199:Lrrc71 UTSW 3 87,743,077 (GRCm38) missense probably damaging 1.00
R7211:Lrrc71 UTSW 3 87,743,326 (GRCm38) missense possibly damaging 0.92
R7634:Lrrc71 UTSW 3 87,742,974 (GRCm38) missense probably damaging 1.00
R7638:Lrrc71 UTSW 3 87,741,806 (GRCm38) missense probably damaging 1.00
R7695:Lrrc71 UTSW 3 87,739,462 (GRCm38) missense probably damaging 1.00
R8971:Lrrc71 UTSW 3 87,739,846 (GRCm38) missense possibly damaging 0.78
R9041:Lrrc71 UTSW 3 87,743,353 (GRCm38) missense probably damaging 0.97
R9427:Lrrc71 UTSW 3 87,743,061 (GRCm38) missense probably benign
R9583:Lrrc71 UTSW 3 87,742,951 (GRCm38) missense possibly damaging 0.78
Z1177:Lrrc71 UTSW 3 87,742,821 (GRCm38) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGCCCAGCCAGCAGATTTTG -3'
(R):5'- TTCAAGACAAGGGAGCACTG -3'

Sequencing Primer
(F):5'- GAACTACGTGCTAGGCAGTATTCC -3'
(R):5'- ACTGAAGCTGGCCGAGGTG -3'
Posted On 2014-08-25