Mutagenetix > Incidental Mutations

Incidental Mutation 'R1987:Prdm2'

222629

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

MMRRC Submission

039999-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1987 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 143132509 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1404 (S1404P)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105778
AA Change: S1404P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: S1404P

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197026

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	T	11: 78,268,167	Q433L	probably damaging	Het
4932438A13Rik	T	A	3: 36,953,985		probably null	Het
Ahnak	A	T	19: 9,015,251	D4633V	probably damaging	Het
Akap6	T	C	12: 53,140,795	F1664S	possibly damaging	Het
Arhgef28	T	C	13: 97,967,096	M803V	probably benign	Het
BC117090	C	A	16: 36,321,832	G61C	probably damaging	Het
Ccdc73	T	A	2: 104,931,045	L130*	probably null	Het
Ccdc73	A	G	2: 104,999,159	E1059G	probably damaging	Het
Ccer2	A	C	7: 28,757,283	S151R	possibly damaging	Het
Cep128	T	A	12: 91,230,829	H406L	probably benign	Het
Cep135	A	G	5: 76,597,428	D229G	probably benign	Het
Cpvl	T	A	6: 53,954,611	D103V	probably benign	Het
Disp3	G	A	4: 148,258,753	A567V	probably damaging	Het
Dnah5	T	C	15: 28,343,591	I2379T	probably damaging	Het
Dnah6	T	C	6: 73,095,044	Y2433C	probably damaging	Het
Dock3	A	G	9: 107,108,421	I85T	probably benign	Het
Dock9	A	C	14: 121,591,830	S1380A	probably benign	Het
Erbin	T	C	13: 103,886,203	T43A	probably benign	Het
Fastkd3	T	C	13: 68,585,241	V502A	possibly damaging	Het
Fn1	T	C	1: 71,651,625	H59R	probably damaging	Het
Fsd2	A	G	7: 81,559,659	V145A	possibly damaging	Het
Fzr1	A	G	10: 81,370,319	V178A	probably damaging	Het
Gnpnat1	T	C	14: 45,380,998	R116G	probably damaging	Het
Grm7	T	A	6: 110,914,511	V235E	probably damaging	Het
Hdac4	A	C	1: 91,934,645	N1002K	probably damaging	Het
Hey1	C	T	3: 8,664,897	A167T	probably benign	Het
Hrnr	A	G	3: 93,332,604	N3383S	unknown	Het
Ints2	A	T	11: 86,217,800	V907D	probably benign	Het
Ispd	T	A	12: 36,521,996	L301Q	probably damaging	Het
Jchain	T	A	5: 88,521,467	Q109L	probably damaging	Het
Klhdc7a	A	T	4: 139,966,024	Y537*	probably null	Het
Klra1	C	T	6: 130,377,779	S92N	probably benign	Het
Krt31	C	T	11: 100,049,580	G150S	probably benign	Het
Lrrc71	G	A	3: 87,742,643	T326M	probably benign	Het
Lrrn4	T	C	2: 132,870,443	T487A	probably benign	Het
Map4k5	T	G	12: 69,842,912	R198S	probably damaging	Het
Men1	G	A	19: 6,338,837	C354Y	probably damaging	Het
Ms4a18	A	T	19: 11,013,655	V25E	probably damaging	Het
Mutyh	T	A	4: 116,819,368	S512R	possibly damaging	Het
Myh10	G	T	11: 68,814,496	A1947S	possibly damaging	Het
Nfasc	T	C	1: 132,610,886	D427G	probably damaging	Het
Nlrp9c	A	G	7: 26,378,056	M767T	probably benign	Het
Nrbp1	T	C	5: 31,245,391	L185P	probably damaging	Het
Pcdh9	G	A	14: 93,888,305	P143L	probably damaging	Het
Pcsk6	A	T	7: 65,927,287	M158L	possibly damaging	Het
Pkd1	G	T	17: 24,576,592		probably null	Het
Plk4	A	T	3: 40,805,817	S383C	possibly damaging	Het
Plxna2	T	C	1: 194,643,989	L77P	probably damaging	Het
Pnpla6	A	T	8: 3,542,370	T1209S	probably benign	Het
Preb	T	C	5: 30,958,813	D150G	probably damaging	Het
Prrt2	A	G	7: 127,018,730	V59A	probably benign	Het
Prss40	T	C	1: 34,558,014	N151S	possibly damaging	Het
Ptprt	A	G	2: 161,766,321	V685A	possibly damaging	Het
Ptprt	G	T	2: 161,558,898	A1053D	probably damaging	Het
Rfx4	C	T	10: 84,896,088	S549F	possibly damaging	Het
Rnaset2b	T	A	17: 6,996,477	V87E	probably benign	Het
Rnf213	G	A	11: 119,441,107	E2381K	probably damaging	Het
Sectm1a	A	T	11: 121,069,680	I103N	probably damaging	Het
Selp	T	A	1: 164,142,758	L597Q	probably damaging	Het
Sema6a	T	C	18: 47,300,142	D74G	probably damaging	Het
Serpinb9b	T	C	13: 33,029,559	V33A	probably benign	Het
Setd1b	A	T	5: 123,147,706	T272S	unknown	Het
Sgf29	G	C	7: 126,649,477		probably null	Het
Slc4a10	C	A	2: 62,268,204	Q561K	probably damaging	Het
Slc4a5	T	C	6: 83,273,232	I649T	possibly damaging	Het
Slc5a7	A	G	17: 54,293,835	Y91H	probably damaging	Het
Styxl1	T	C	5: 135,757,122	Y23C	probably damaging	Het
Tbc1d24	A	G	17: 24,206,872	V490A	possibly damaging	Het
Tbpl2	A	T	2: 24,094,732	F133L	probably benign	Het
Tcrg-C3	C	A	13: 19,260,994	F37L	probably damaging	Het
Tnfrsf22	T	C	7: 143,638,389		probably benign	Het
Top2b	A	G	14: 16,398,916	E512G	probably damaging	Het
Ttc17	T	A	2: 94,364,345	H561L	probably benign	Het
Ttll4	G	T	1: 74,685,368	V566L	possibly damaging	Het
Ubqlnl	A	G	7: 104,148,485	Y602H	probably benign	Het
Vmn1r231	T	A	17: 20,889,950	E234D	probably damaging	Het
Wbp11	A	G	6: 136,820,585	S279P	probably damaging	Het
Wdr6	A	G	9: 108,576,534	L50P	probably damaging	Het
Zfp715	A	C	7: 43,298,649	I629S	possibly damaging	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0153:Prdm2	UTSW	4	143133768	missense	possibly damaging	0.93
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0658:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1936:Prdm2	UTSW	4	143134462	missense	probably benign	0.00
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2030:Prdm2	UTSW	4	143132764	missense	possibly damaging	0.53
R2112:Prdm2	UTSW	4	143131936	missense	probably benign
R2221:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2426:Prdm2	UTSW	4	143111750	nonsense	probably null
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6223:Prdm2	UTSW	4	143142207	missense	probably benign	0.41
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6631:Prdm2	UTSW	4	143134884	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7417:Prdm2	UTSW	4	143179299	missense	probably damaging	1.00
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7968:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TATTCAGGCTGCCGATGTACG -3'
(R):5'- TGGCAAGAGTGTTGATAACATGC -3'

Sequencing Primer
(F):5'- GTGAACTCCCTGTCACAGTAAGG -3'
(R):5'- TGATAACATGCCTGAGCTGC -3'

Posted On

2014-08-25