Incidental Mutation 'R1987:Setd1b'
ID222641
Institutional Source Beutler Lab
Gene Symbol Setd1b
Ensembl Gene ENSMUSG00000038384
Gene NameSET domain containing 1B
SynonymsKMT2G
MMRRC Submission 039999-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1987 (G1)
Quality Score216
Status Not validated
Chromosome5
Chromosomal Location123142193-123168629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123147706 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 272 (T272S)
Ref Sequence ENSEMBL: ENSMUSP00000134461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056053] [ENSMUST00000163030] [ENSMUST00000174836]
Predicted Effect unknown
Transcript: ENSMUST00000056053
AA Change: T272S
SMART Domains Protein: ENSMUSP00000134686
Gene: ENSMUSG00000038384
AA Change: T272S

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.29e-7 PROSPERO
internal_repeat_1 279 296 1.29e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
coiled coil region 1190 1213 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1281 1292 N/A INTRINSIC
low complexity region 1322 1383 N/A INTRINSIC
low complexity region 1402 1442 N/A INTRINSIC
low complexity region 1484 1548 N/A INTRINSIC
low complexity region 1600 1618 N/A INTRINSIC
N-SET 1692 1836 1.54e-67 SMART
SET 1846 1969 4.03e-36 SMART
PostSET 1969 1985 4.8e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100731
Predicted Effect unknown
Transcript: ENSMUST00000163030
AA Change: T272S
SMART Domains Protein: ENSMUSP00000133933
Gene: ENSMUSG00000038384
AA Change: T272S

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.29e-7 PROSPERO
internal_repeat_1 279 296 1.29e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
coiled coil region 1190 1213 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1281 1292 N/A INTRINSIC
low complexity region 1322 1383 N/A INTRINSIC
low complexity region 1402 1442 N/A INTRINSIC
low complexity region 1484 1548 N/A INTRINSIC
low complexity region 1600 1618 N/A INTRINSIC
N-SET 1692 1836 1.54e-67 SMART
SET 1846 1969 4.03e-36 SMART
PostSET 1969 1985 4.8e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174836
AA Change: T272S
SMART Domains Protein: ENSMUSP00000134461
Gene: ENSMUSG00000038384
AA Change: T272S

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.92e-7 PROSPERO
internal_repeat_1 279 296 1.92e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
coiled coil region 1149 1172 N/A INTRINSIC
low complexity region 1208 1221 N/A INTRINSIC
low complexity region 1240 1251 N/A INTRINSIC
low complexity region 1281 1342 N/A INTRINSIC
low complexity region 1361 1401 N/A INTRINSIC
low complexity region 1443 1507 N/A INTRINSIC
low complexity region 1559 1577 N/A INTRINSIC
N-SET 1651 1795 1.54e-67 SMART
SET 1805 1928 4.03e-36 SMART
PostSET 1928 1944 4.8e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181022
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant animals died during organogenesis by E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A T 11: 78,268,167 Q433L probably damaging Het
4932438A13Rik T A 3: 36,953,985 probably null Het
Ahnak A T 19: 9,015,251 D4633V probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Arhgef28 T C 13: 97,967,096 M803V probably benign Het
BC117090 C A 16: 36,321,832 G61C probably damaging Het
Ccdc73 T A 2: 104,931,045 L130* probably null Het
Ccdc73 A G 2: 104,999,159 E1059G probably damaging Het
Ccer2 A C 7: 28,757,283 S151R possibly damaging Het
Cep128 T A 12: 91,230,829 H406L probably benign Het
Cep135 A G 5: 76,597,428 D229G probably benign Het
Cpvl T A 6: 53,954,611 D103V probably benign Het
Disp3 G A 4: 148,258,753 A567V probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 T C 6: 73,095,044 Y2433C probably damaging Het
Dock3 A G 9: 107,108,421 I85T probably benign Het
Dock9 A C 14: 121,591,830 S1380A probably benign Het
Erbin T C 13: 103,886,203 T43A probably benign Het
Fastkd3 T C 13: 68,585,241 V502A possibly damaging Het
Fn1 T C 1: 71,651,625 H59R probably damaging Het
Fsd2 A G 7: 81,559,659 V145A possibly damaging Het
Fzr1 A G 10: 81,370,319 V178A probably damaging Het
Gnpnat1 T C 14: 45,380,998 R116G probably damaging Het
Grm7 T A 6: 110,914,511 V235E probably damaging Het
Hdac4 A C 1: 91,934,645 N1002K probably damaging Het
Hey1 C T 3: 8,664,897 A167T probably benign Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Ints2 A T 11: 86,217,800 V907D probably benign Het
Ispd T A 12: 36,521,996 L301Q probably damaging Het
Jchain T A 5: 88,521,467 Q109L probably damaging Het
Klhdc7a A T 4: 139,966,024 Y537* probably null Het
Klra1 C T 6: 130,377,779 S92N probably benign Het
Krt31 C T 11: 100,049,580 G150S probably benign Het
Lrrc71 G A 3: 87,742,643 T326M probably benign Het
Lrrn4 T C 2: 132,870,443 T487A probably benign Het
Map4k5 T G 12: 69,842,912 R198S probably damaging Het
Men1 G A 19: 6,338,837 C354Y probably damaging Het
Ms4a18 A T 19: 11,013,655 V25E probably damaging Het
Mutyh T A 4: 116,819,368 S512R possibly damaging Het
Myh10 G T 11: 68,814,496 A1947S possibly damaging Het
Nfasc T C 1: 132,610,886 D427G probably damaging Het
Nlrp9c A G 7: 26,378,056 M767T probably benign Het
Nrbp1 T C 5: 31,245,391 L185P probably damaging Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pcsk6 A T 7: 65,927,287 M158L possibly damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Pnpla6 A T 8: 3,542,370 T1209S probably benign Het
Prdm2 A G 4: 143,132,509 S1404P possibly damaging Het
Preb T C 5: 30,958,813 D150G probably damaging Het
Prrt2 A G 7: 127,018,730 V59A probably benign Het
Prss40 T C 1: 34,558,014 N151S possibly damaging Het
Ptprt G T 2: 161,558,898 A1053D probably damaging Het
Ptprt A G 2: 161,766,321 V685A possibly damaging Het
Rfx4 C T 10: 84,896,088 S549F possibly damaging Het
Rnaset2b T A 17: 6,996,477 V87E probably benign Het
Rnf213 G A 11: 119,441,107 E2381K probably damaging Het
Sectm1a A T 11: 121,069,680 I103N probably damaging Het
Selp T A 1: 164,142,758 L597Q probably damaging Het
Sema6a T C 18: 47,300,142 D74G probably damaging Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Sgf29 G C 7: 126,649,477 probably null Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Slc4a5 T C 6: 83,273,232 I649T possibly damaging Het
Slc5a7 A G 17: 54,293,835 Y91H probably damaging Het
Styxl1 T C 5: 135,757,122 Y23C probably damaging Het
Tbc1d24 A G 17: 24,206,872 V490A possibly damaging Het
Tbpl2 A T 2: 24,094,732 F133L probably benign Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tnfrsf22 T C 7: 143,638,389 probably benign Het
Top2b A G 14: 16,398,916 E512G probably damaging Het
Ttc17 T A 2: 94,364,345 H561L probably benign Het
Ttll4 G T 1: 74,685,368 V566L possibly damaging Het
Ubqlnl A G 7: 104,148,485 Y602H probably benign Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Wbp11 A G 6: 136,820,585 S279P probably damaging Het
Wdr6 A G 9: 108,576,534 L50P probably damaging Het
Zfp715 A C 7: 43,298,649 I629S possibly damaging Het
Other mutations in Setd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Setd1b APN 5 123158747 unclassified probably benign
IGL01453:Setd1b APN 5 123158464 intron probably benign
IGL01637:Setd1b APN 5 123148513 missense unknown
IGL01792:Setd1b APN 5 123157146 missense unknown
IGL01877:Setd1b APN 5 123148448 missense unknown
IGL01906:Setd1b APN 5 123157667 missense unknown
IGL01942:Setd1b APN 5 123163426 missense possibly damaging 0.73
IGL02284:Setd1b APN 5 123163428 missense possibly damaging 0.52
IGL02667:Setd1b APN 5 123157497 missense unknown
IGL02850:Setd1b APN 5 123148589 missense unknown
IGL02864:Setd1b APN 5 123158939 unclassified probably benign
IGL03006:Setd1b APN 5 123148451 missense unknown
IGL03307:Setd1b APN 5 123148671 missense unknown
P0037:Setd1b UTSW 5 123165921 unclassified probably benign
R0282:Setd1b UTSW 5 123161017 unclassified probably benign
R0375:Setd1b UTSW 5 123157437 missense unknown
R0550:Setd1b UTSW 5 123157660 missense unknown
R0607:Setd1b UTSW 5 123159951 unclassified probably benign
R0844:Setd1b UTSW 5 123160685 unclassified probably benign
R0973:Setd1b UTSW 5 123160703 small insertion probably benign
R1119:Setd1b UTSW 5 123147716 missense unknown
R1266:Setd1b UTSW 5 123147841 missense unknown
R1370:Setd1b UTSW 5 123160685 unclassified probably benign
R1416:Setd1b UTSW 5 123160685 unclassified probably benign
R1575:Setd1b UTSW 5 123163147 splice site probably benign
R1862:Setd1b UTSW 5 123147613 missense unknown
R4109:Setd1b UTSW 5 123152074 small deletion probably benign
R4399:Setd1b UTSW 5 123161798 unclassified probably benign
R4445:Setd1b UTSW 5 123148104 missense unknown
R4577:Setd1b UTSW 5 123148616 missense unknown
R4604:Setd1b UTSW 5 123152074 small deletion probably benign
R4647:Setd1b UTSW 5 123148112 missense unknown
R4648:Setd1b UTSW 5 123148112 missense unknown
R4675:Setd1b UTSW 5 123160998 unclassified probably benign
R5044:Setd1b UTSW 5 123151866 missense unknown
R5071:Setd1b UTSW 5 123160914 unclassified probably benign
R5220:Setd1b UTSW 5 123143408 missense unknown
R5933:Setd1b UTSW 5 123158752 unclassified probably benign
R6247:Setd1b UTSW 5 123158398 intron probably benign
R6446:Setd1b UTSW 5 123161799 unclassified probably benign
R6714:Setd1b UTSW 5 123157591 missense unknown
R6907:Setd1b UTSW 5 123163232 unclassified probably benign
R7328:Setd1b UTSW 5 123152379 missense unknown
R7412:Setd1b UTSW 5 123152576 missense unknown
R7486:Setd1b UTSW 5 123163592 missense probably benign 0.03
R7542:Setd1b UTSW 5 123148447 missense unknown
R7555:Setd1b UTSW 5 123157757 missense unknown
R7611:Setd1b UTSW 5 123152594 missense unknown
R7764:Setd1b UTSW 5 123146559 missense unknown
R7770:Setd1b UTSW 5 123158752 unclassified probably benign
R7881:Setd1b UTSW 5 123152273 missense unknown
R7977:Setd1b UTSW 5 123147680 missense unknown
R7987:Setd1b UTSW 5 123147680 missense unknown
R8131:Setd1b UTSW 5 123143380 missense unknown
R8386:Setd1b UTSW 5 123144256 missense unknown
R8845:Setd1b UTSW 5 123144247 missense unknown
R8901:Setd1b UTSW 5 123161051 unclassified probably benign
Z1177:Setd1b UTSW 5 123158625 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAATTGCCTGGTTCAGCTCG -3'
(R):5'- GACATAATGATGTTCGTGGCGG -3'

Sequencing Primer
(F):5'- TGGTTCAGCTCGGTCCTC -3'
(R):5'- GCGGTTGTAGGCATCTGTGAAC -3'
Posted On2014-08-25