Incidental Mutation 'R2014:Espl1'
ID 222656
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission 040023-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2014 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 102231149 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 17 (R17*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001335] [ENSMUST00000062492] [ENSMUST00000064924] [ENSMUST00000165671] [ENSMUST00000165717] [ENSMUST00000166658] [ENSMUST00000170627] [ENSMUST00000229050] [ENSMUST00000169637]
AlphaFold P60330
Predicted Effect probably benign
Transcript: ENSMUST00000001335
SMART Domains Protein: ENSMUSP00000001335
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
SCOP:d1fxkc_ 12 58 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062492
SMART Domains Protein: ENSMUSP00000126970
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 75 2.2e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000064924
AA Change: R1883*
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: R1883*

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165671
SMART Domains Protein: ENSMUSP00000128526
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 75 2.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165717
SMART Domains Protein: ENSMUSP00000132441
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 72 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166658
SMART Domains Protein: ENSMUSP00000129178
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 22 143 8.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168805
Predicted Effect probably null
Transcript: ENSMUST00000229942
AA Change: R17*
Predicted Effect probably benign
Transcript: ENSMUST00000170627
SMART Domains Protein: ENSMUSP00000131245
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 7 99 4.6e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230222
Predicted Effect probably null
Transcript: ENSMUST00000229050
AA Change: R1883*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230617
Predicted Effect probably benign
Transcript: ENSMUST00000169637
SMART Domains Protein: ENSMUSP00000128263
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 58 3.4e-19 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T G 17: 48,347,723 (GRCm39) T194P possibly damaging Het
Aadacl4fm5 A T 4: 144,506,295 (GRCm39) L132Q probably damaging Het
Acsbg2 T A 17: 57,160,855 (GRCm39) K263M possibly damaging Het
Adcy8 C T 15: 64,639,727 (GRCm39) G678S probably benign Het
Adgrl2 C T 3: 148,532,111 (GRCm39) G1041R probably damaging Het
Ahnak T C 19: 8,990,545 (GRCm39) I3943T probably damaging Het
Aire T C 10: 77,878,792 (GRCm39) D85G probably damaging Het
Alkbh8 C T 9: 3,343,216 (GRCm39) Q36* probably null Het
Amer3 T C 1: 34,618,525 (GRCm39) probably benign Het
Angptl8 T C 9: 21,748,358 (GRCm39) probably null Het
Ankmy1 T C 1: 92,812,863 (GRCm39) D482G probably benign Het
Apc A G 18: 34,448,644 (GRCm39) I1813V probably damaging Het
Asb13 T G 13: 3,699,512 (GRCm39) probably null Het
Blm T C 7: 80,152,147 (GRCm39) E600G probably damaging Het
Cd163 G T 6: 124,302,457 (GRCm39) W1007L probably damaging Het
Cdr1 A G X: 60,228,420 (GRCm39) F249L probably benign Het
Cp A G 3: 20,041,598 (GRCm39) K44E probably benign Het
Crtap C A 9: 114,210,653 (GRCm39) probably null Het
Ctsk A G 3: 95,414,003 (GRCm39) D250G probably damaging Het
Dcp2 T C 18: 44,543,363 (GRCm39) V307A probably benign Het
Dnah6 T A 6: 73,150,402 (GRCm39) D787V probably damaging Het
Dtx3l G A 16: 35,756,797 (GRCm39) H129Y probably benign Het
Ece2 A G 16: 20,461,067 (GRCm39) T442A probably benign Het
Espn G T 4: 152,217,416 (GRCm39) probably null Het
Fam20b C T 1: 156,533,511 (GRCm39) R35Q possibly damaging Het
Fga A G 3: 82,940,064 (GRCm39) I573V probably damaging Het
Fmo5 A G 3: 97,542,998 (GRCm39) K103E possibly damaging Het
Frem1 A T 4: 82,924,089 (GRCm39) V291D probably damaging Het
Gabbr1 A G 17: 37,367,674 (GRCm39) probably null Het
Gjb6 T C 14: 57,362,213 (GRCm39) H16R probably damaging Het
Grina T C 15: 76,132,734 (GRCm39) V167A probably damaging Het
Gulo T A 14: 66,246,496 (GRCm39) M1L probably benign Het
Hcfc2 A G 10: 82,574,814 (GRCm39) N618D probably benign Het
Heatr5b T C 17: 79,121,613 (GRCm39) D704G probably damaging Het
Hlcs A G 16: 94,063,599 (GRCm39) V487A probably benign Het
Hps1 G A 19: 42,750,951 (GRCm39) P350S probably benign Het
Hspa9 A T 18: 35,079,701 (GRCm39) Y243N probably damaging Het
Igll1 A G 16: 16,681,639 (GRCm39) S39P probably benign Het
Kif21b T C 1: 136,076,020 (GRCm39) F270L probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt27 A G 11: 99,240,318 (GRCm39) V200A probably benign Het
Lama3 T C 18: 12,657,778 (GRCm39) probably benign Het
Lmcd1 T C 6: 112,305,702 (GRCm39) W268R probably damaging Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Mamdc4 T A 2: 25,453,584 (GRCm39) D1195V probably damaging Het
Map2 T C 1: 66,455,295 (GRCm39) V1395A possibly damaging Het
Map3k20 C T 2: 72,268,604 (GRCm39) T537M probably benign Het
Mdga1 A G 17: 30,068,287 (GRCm39) S276P probably damaging Het
Mep1a T C 17: 43,808,797 (GRCm39) N85D probably benign Het
Mettl16 A G 11: 74,708,195 (GRCm39) S425G probably benign Het
Mthfd1l A G 10: 3,997,894 (GRCm39) T622A probably benign Het
Nbeal2 G A 9: 110,463,139 (GRCm39) L1309F probably benign Het
Nde1 A T 16: 13,987,321 (GRCm39) probably benign Het
Nhsl1 A T 10: 18,387,340 (GRCm39) R205W probably damaging Het
Nlrc5 A G 8: 95,252,138 (GRCm39) probably benign Het
Notch3 C A 17: 32,376,974 (GRCm39) E310D probably benign Het
Or2f1 A G 6: 42,721,784 (GRCm39) E271G probably damaging Het
Or4p19 T C 2: 88,242,388 (GRCm39) T205A probably benign Het
Or5ak24 T A 2: 85,260,696 (GRCm39) H159L possibly damaging Het
Or7a39 T C 10: 78,715,222 (GRCm39) I72T possibly damaging Het
Osbpl5 C A 7: 143,295,429 (GRCm39) C11F probably damaging Het
P4hb T C 11: 120,453,522 (GRCm39) E381G probably damaging Het
Pax4 A G 6: 28,446,209 (GRCm39) Y95H probably benign Het
Pdia3 T C 2: 121,265,301 (GRCm39) V390A probably damaging Het
Pigv A C 4: 133,390,034 (GRCm39) D49E possibly damaging Het
Pik3c2a T A 7: 115,950,166 (GRCm39) probably null Het
Plxnb1 T A 9: 108,935,687 (GRCm39) probably benign Het
Polq A G 16: 36,898,728 (GRCm39) T2163A probably damaging Het
Pou5f2 T C 13: 78,173,972 (GRCm39) S305P probably benign Het
Ppm1h A T 10: 122,756,630 (GRCm39) H425L possibly damaging Het
Ppp1r13b G T 12: 111,800,222 (GRCm39) D518E probably benign Het
Prf1 A T 10: 61,139,674 (GRCm39) D544V probably benign Het
Prl3b1 T C 13: 27,431,948 (GRCm39) F158L probably benign Het
Prss41 C T 17: 24,056,464 (GRCm39) probably null Het
Prune2 T G 19: 17,097,887 (GRCm39) N1130K probably damaging Het
Ptgdr2 T C 19: 10,917,789 (GRCm39) F102S probably damaging Het
Ptprq T G 10: 107,503,283 (GRCm39) K792Q probably damaging Het
Pttg1ip2 T A 5: 5,505,964 (GRCm39) I106L probably benign Het
Rcbtb2 T C 14: 73,411,826 (GRCm39) probably benign Het
Rgs14 C A 13: 55,531,513 (GRCm39) S479* probably null Het
Sash1 A T 10: 8,605,177 (GRCm39) V1071D probably benign Het
Sdsl G A 5: 120,601,218 (GRCm39) T18M probably damaging Het
Sepsecs T A 5: 52,804,966 (GRCm39) Q365L probably benign Het
Sh2d4a A T 8: 68,783,735 (GRCm39) Q223L probably damaging Het
Slc14a2 T C 18: 78,193,601 (GRCm39) probably benign Het
Slc5a9 A C 4: 111,753,546 (GRCm39) S52A possibly damaging Het
Slc6a18 C A 13: 73,823,844 (GRCm39) V99L probably benign Het
Smarca2 T C 19: 26,661,305 (GRCm39) S967P possibly damaging Het
Tbc1d22a C T 15: 86,183,885 (GRCm39) T248M probably damaging Het
Tcte1 A T 17: 45,852,237 (GRCm39) N490I probably benign Het
Tet3 T C 6: 83,363,057 (GRCm39) E705G probably damaging Het
Tfeb T A 17: 48,102,484 (GRCm39) H450Q probably damaging Het
Tmem248 G A 5: 130,260,653 (GRCm39) E73K probably damaging Het
Trip12 A T 1: 84,738,587 (GRCm39) L756* probably null Het
Try5 C T 6: 41,291,585 (GRCm39) probably null Het
Tsc1 A T 2: 28,555,649 (GRCm39) probably benign Het
Tspear G A 10: 77,710,954 (GRCm39) probably benign Het
Ttc6 T C 12: 57,623,003 (GRCm39) I134T possibly damaging Het
Ttn T A 2: 76,585,640 (GRCm39) probably null Het
Ube3b A G 5: 114,549,210 (GRCm39) E738G probably damaging Het
Usp36 T C 11: 118,153,334 (GRCm39) probably benign Het
Vmn2r71 T A 7: 85,269,845 (GRCm39) M452K probably benign Het
Vps13b T C 15: 35,607,288 (GRCm39) S1074P probably damaging Het
Vps13d A G 4: 144,835,078 (GRCm39) S2757P probably damaging Het
Vwde C A 6: 13,208,337 (GRCm39) G182C possibly damaging Het
Wdr33 T C 18: 31,966,652 (GRCm39) V164A probably damaging Het
Zkscan16 A G 4: 58,956,525 (GRCm39) Y269C possibly damaging Het
Zup1 A G 10: 33,805,820 (GRCm39) V437A possibly damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCCACTCTCCTGAAAGTGAG -3'
(R):5'- GCTTTCCCAAGGCAGCTTTTG -3'

Sequencing Primer
(F):5'- GGGGAAAATAGTTCTGTCCCACC -3'
(R):5'- AGACCCCATGCTCATTAC -3'
Posted On 2014-08-25