Mutagenetix > Incidental Mutation

Incidental Mutation 'R2014:Espl1'

222656

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

040023-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2014 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 102322714 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 17 (R17*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001335] [ENSMUST00000062492] [ENSMUST00000064924] [ENSMUST00000165671] [ENSMUST00000165717] [ENSMUST00000166658] [ENSMUST00000169637] [ENSMUST00000170627] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably benign
Transcript: ENSMUST00000001335

SMART Domains

Protein: ENSMUSP00000001335
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
SCOP:d1fxkc_	12	58	4e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000062492

SMART Domains

Protein: ENSMUSP00000126970
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	75	2.2e-20	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000064924
AA Change: R1883*

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: R1883*

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165671

SMART Domains

Protein: ENSMUSP00000128526
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	75	2.2e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165717

SMART Domains

Protein: ENSMUSP00000132441
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	72	1.4e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166658

SMART Domains

Protein: ENSMUSP00000129178
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	22	143	8.6e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168805

Predicted Effect

probably benign
Transcript: ENSMUST00000169637

SMART Domains

Protein: ENSMUSP00000128263
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	58	3.4e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170627

SMART Domains

Protein: ENSMUSP00000131245
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	7	99	4.6e-22	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000229050
AA Change: R1883*

Predicted Effect

probably null
Transcript: ENSMUST00000229942
AA Change: R17*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230222

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230617

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231207

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

96% (105/109)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	T	A	5: 5,455,964	I106L	probably benign	Het
1700122O11Rik	T	G	17: 48,036,914	T194P	possibly damaging	Het
Acsbg2	T	A	17: 56,853,855	K263M	possibly damaging	Het
Adcy8	C	T	15: 64,767,878	G678S	probably benign	Het
Adgrl2	C	T	3: 148,826,475	G1041R	probably damaging	Het
Ahnak	T	C	19: 9,013,181	I3943T	probably damaging	Het
Aire	T	C	10: 78,042,958	D85G	probably damaging	Het
Alkbh8	C	T	9: 3,343,216	Q36*	probably null	Het
Amer3	T	C	1: 34,579,444		probably benign	Het
Angptl8	T	C	9: 21,837,062		probably null	Het
Ankmy1	T	C	1: 92,885,141	D482G	probably benign	Het
Apc	A	G	18: 34,315,591	I1813V	probably damaging	Het
Asb13	T	G	13: 3,649,512		probably null	Het
Blm	T	C	7: 80,502,399	E600G	probably damaging	Het
Cd163	G	T	6: 124,325,498	W1007L	probably damaging	Het
Cdr1	A	G	X: 61,184,814	F249L	probably benign	Het
Cp	A	G	3: 19,987,434	K44E	probably benign	Het
Crtap	C	A	9: 114,381,585		probably null	Het
Ctsk	A	G	3: 95,506,692	D250G	probably damaging	Het
Dcp2	T	C	18: 44,410,296	V307A	probably benign	Het
Dnah6	T	A	6: 73,173,419	D787V	probably damaging	Het
Dtx3l	G	A	16: 35,936,427	H129Y	probably benign	Het
Ece2	A	G	16: 20,642,317	T442A	probably benign	Het
Espn	G	T	4: 152,132,959		probably null	Het
Fam20b	C	T	1: 156,705,941	R35Q	possibly damaging	Het
Fga	A	G	3: 83,032,757	I573V	probably damaging	Het
Fmo5	A	G	3: 97,635,682	K103E	possibly damaging	Het
Frem1	A	T	4: 83,005,852	V291D	probably damaging	Het
Gabbr1	A	G	17: 37,056,782		probably null	Het
Gjb6	T	C	14: 57,124,756	H16R	probably damaging	Het
Gm438	A	T	4: 144,779,725	L132Q	probably damaging	Het
Grina	T	C	15: 76,248,534	V167A	probably damaging	Het
Gulo	T	A	14: 66,009,047	M1L	probably benign	Het
Hcfc2	A	G	10: 82,738,980	N618D	probably benign	Het
Heatr5b	T	C	17: 78,814,184	D704G	probably damaging	Het
Hlcs	A	G	16: 94,262,740	V487A	probably benign	Het
Hps1	G	A	19: 42,762,512	P350S	probably benign	Het
Hspa9	A	T	18: 34,946,648	Y243N	probably damaging	Het
Igll1	A	G	16: 16,863,775	S39P	probably benign	Het
Kif21b	T	C	1: 136,148,282	F270L	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt27	A	G	11: 99,349,492	V200A	probably benign	Het
Lama3	T	C	18: 12,524,721		probably benign	Het
Lmcd1	T	C	6: 112,328,741	W268R	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Mamdc4	T	A	2: 25,563,572	D1195V	probably damaging	Het
Map2	T	C	1: 66,416,136	V1395A	possibly damaging	Het
Map3k20	C	T	2: 72,438,260	T537M	probably benign	Het
Mdga1	A	G	17: 29,849,313	S276P	probably damaging	Het
Mep1a	T	C	17: 43,497,906	N85D	probably benign	Het
Mettl16	A	G	11: 74,817,369	S425G	probably benign	Het
Mthfd1l	A	G	10: 4,047,894	T622A	probably benign	Het
Nbeal2	G	A	9: 110,634,071	L1309F	probably benign	Het
Nde1	A	T	16: 14,169,457		probably benign	Het
Nhsl1	A	T	10: 18,511,592	R205W	probably damaging	Het
Nlrc5	A	G	8: 94,525,510		probably benign	Het
Notch3	C	A	17: 32,158,000	E310D	probably benign	Het
Olfr1180	T	C	2: 88,412,044	T205A	probably benign	Het
Olfr1355	T	C	10: 78,879,388	I72T	possibly damaging	Het
Olfr453	A	G	6: 42,744,850	E271G	probably damaging	Het
Olfr994	T	A	2: 85,430,352	H159L	possibly damaging	Het
Osbpl5	C	A	7: 143,741,692	C11F	probably damaging	Het
P4hb	T	C	11: 120,562,696	E381G	probably damaging	Het
Pax4	A	G	6: 28,446,210	Y95H	probably benign	Het
Pdia3	T	C	2: 121,434,820	V390A	probably damaging	Het
Pigv	A	C	4: 133,662,723	D49E	possibly damaging	Het
Pik3c2a	T	A	7: 116,350,931		probably null	Het
Plxnb1	T	A	9: 109,106,619		probably benign	Het
Polq	A	G	16: 37,078,366	T2163A	probably damaging	Het
Pou5f2	T	C	13: 78,025,853	S305P	probably benign	Het
Ppm1h	A	T	10: 122,920,725	H425L	possibly damaging	Het
Ppp1r13b	G	T	12: 111,833,788	D518E	probably benign	Het
Prf1	A	T	10: 61,303,895	D544V	probably benign	Het
Prl3b1	T	C	13: 27,247,965	F158L	probably benign	Het
Prss41	C	T	17: 23,837,490		probably null	Het
Prune2	T	G	19: 17,120,523	N1130K	probably damaging	Het
Ptgdr2	T	C	19: 10,940,425	F102S	probably damaging	Het
Ptprq	T	G	10: 107,667,422	K792Q	probably damaging	Het
Rcbtb2	T	C	14: 73,174,386		probably benign	Het
Rgs14	C	A	13: 55,383,700	S479*	probably null	Het
Sash1	A	T	10: 8,729,413	V1071D	probably benign	Het
Sdsl	G	A	5: 120,463,153	T18M	probably damaging	Het
Sepsecs	T	A	5: 52,647,624	Q365L	probably benign	Het
Sh2d4a	A	T	8: 68,331,083	Q223L	probably damaging	Het
Slc14a2	T	C	18: 78,150,386		probably benign	Het
Slc5a9	A	C	4: 111,896,349	S52A	possibly damaging	Het
Slc6a18	C	A	13: 73,675,725	V99L	probably benign	Het
Smarca2	T	C	19: 26,683,905	S967P	possibly damaging	Het
Tbc1d22a	C	T	15: 86,299,684	T248M	probably damaging	Het
Tcte1	A	T	17: 45,541,311	N490I	probably benign	Het
Tet3	T	C	6: 83,386,075	E705G	probably damaging	Het
Tfeb	T	A	17: 47,791,559	H450Q	probably damaging	Het
Tmem248	G	A	5: 130,231,812	E73K	probably damaging	Het
Trip12	A	T	1: 84,760,866	L756*	probably null	Het
Try5	C	T	6: 41,314,651		probably null	Het
Tsc1	A	T	2: 28,665,637		probably benign	Het
Tspear	G	A	10: 77,875,120		probably benign	Het
Ttc6	T	C	12: 57,576,217	I134T	possibly damaging	Het
Ttn	T	A	2: 76,755,296		probably null	Het
Ube3b	A	G	5: 114,411,149	E738G	probably damaging	Het
Usp36	T	C	11: 118,262,508		probably benign	Het
Vmn2r71	T	A	7: 85,620,637	M452K	probably benign	Het
Vps13b	T	C	15: 35,607,142	S1074P	probably damaging	Het
Vps13d	A	G	4: 145,108,508	S2757P	probably damaging	Het
Vwde	C	A	6: 13,208,338	G182C	possibly damaging	Het
Wdr33	T	C	18: 31,833,599	V164A	probably damaging	Het
Zkscan16	A	G	4: 58,956,525	Y269C	possibly damaging	Het
Zufsp	A	G	10: 33,929,824	V437A	possibly damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTCCACTCTCCTGAAAGTGAG -3'
(R):5'- GCTTTCCCAAGGCAGCTTTTG -3'

Sequencing Primer
(F):5'- GGGGAAAATAGTTCTGTCCCACC -3'
(R):5'- AGACCCCATGCTCATTAC -3'

Posted On

2014-08-25