Incidental Mutation 'R1987:Fsd2'
ID222666
Institutional Source Beutler Lab
Gene Symbol Fsd2
Ensembl Gene ENSMUSG00000038663
Gene Namefibronectin type III and SPRY domain containing 2
SynonymsSpryd1, 9830160G03Rik
MMRRC Submission 039999-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1987 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location81533308-81566944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81559659 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 145 (V145A)
Ref Sequence ENSEMBL: ENSMUSP00000047775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042318]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042318
AA Change: V145A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047775
Gene: ENSMUSG00000038663
AA Change: V145A

DomainStartEndE-ValueType
low complexity region 102 121 N/A INTRINSIC
coiled coil region 204 231 N/A INTRINSIC
FN3 315 400 7.34e-9 SMART
FN3 412 494 2e-1 SMART
Pfam:PRY 509 558 8.6e-9 PFAM
Pfam:SPRY 564 683 2.8e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the FN3/SPRY family of proteins. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A T 11: 78,268,167 Q433L probably damaging Het
4932438A13Rik T A 3: 36,953,985 probably null Het
Ahnak A T 19: 9,015,251 D4633V probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Arhgef28 T C 13: 97,967,096 M803V probably benign Het
BC117090 C A 16: 36,321,832 G61C probably damaging Het
Ccdc73 T A 2: 104,931,045 L130* probably null Het
Ccdc73 A G 2: 104,999,159 E1059G probably damaging Het
Ccer2 A C 7: 28,757,283 S151R possibly damaging Het
Cep128 T A 12: 91,230,829 H406L probably benign Het
Cep135 A G 5: 76,597,428 D229G probably benign Het
Cpvl T A 6: 53,954,611 D103V probably benign Het
Disp3 G A 4: 148,258,753 A567V probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 T C 6: 73,095,044 Y2433C probably damaging Het
Dock3 A G 9: 107,108,421 I85T probably benign Het
Dock9 A C 14: 121,591,830 S1380A probably benign Het
Erbin T C 13: 103,886,203 T43A probably benign Het
Fastkd3 T C 13: 68,585,241 V502A possibly damaging Het
Fn1 T C 1: 71,651,625 H59R probably damaging Het
Fzr1 A G 10: 81,370,319 V178A probably damaging Het
Gnpnat1 T C 14: 45,380,998 R116G probably damaging Het
Grm7 T A 6: 110,914,511 V235E probably damaging Het
Hdac4 A C 1: 91,934,645 N1002K probably damaging Het
Hey1 C T 3: 8,664,897 A167T probably benign Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Ints2 A T 11: 86,217,800 V907D probably benign Het
Ispd T A 12: 36,521,996 L301Q probably damaging Het
Jchain T A 5: 88,521,467 Q109L probably damaging Het
Klhdc7a A T 4: 139,966,024 Y537* probably null Het
Klra1 C T 6: 130,377,779 S92N probably benign Het
Krt31 C T 11: 100,049,580 G150S probably benign Het
Lrrc71 G A 3: 87,742,643 T326M probably benign Het
Lrrn4 T C 2: 132,870,443 T487A probably benign Het
Map4k5 T G 12: 69,842,912 R198S probably damaging Het
Men1 G A 19: 6,338,837 C354Y probably damaging Het
Ms4a18 A T 19: 11,013,655 V25E probably damaging Het
Mutyh T A 4: 116,819,368 S512R possibly damaging Het
Myh10 G T 11: 68,814,496 A1947S possibly damaging Het
Nfasc T C 1: 132,610,886 D427G probably damaging Het
Nlrp9c A G 7: 26,378,056 M767T probably benign Het
Nrbp1 T C 5: 31,245,391 L185P probably damaging Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pcsk6 A T 7: 65,927,287 M158L possibly damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Pnpla6 A T 8: 3,542,370 T1209S probably benign Het
Prdm2 A G 4: 143,132,509 S1404P possibly damaging Het
Preb T C 5: 30,958,813 D150G probably damaging Het
Prrt2 A G 7: 127,018,730 V59A probably benign Het
Prss40 T C 1: 34,558,014 N151S possibly damaging Het
Ptprt G T 2: 161,558,898 A1053D probably damaging Het
Ptprt A G 2: 161,766,321 V685A possibly damaging Het
Rfx4 C T 10: 84,896,088 S549F possibly damaging Het
Rnaset2b T A 17: 6,996,477 V87E probably benign Het
Rnf213 G A 11: 119,441,107 E2381K probably damaging Het
Sectm1a A T 11: 121,069,680 I103N probably damaging Het
Selp T A 1: 164,142,758 L597Q probably damaging Het
Sema6a T C 18: 47,300,142 D74G probably damaging Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Setd1b A T 5: 123,147,706 T272S unknown Het
Sgf29 G C 7: 126,649,477 probably null Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Slc4a5 T C 6: 83,273,232 I649T possibly damaging Het
Slc5a7 A G 17: 54,293,835 Y91H probably damaging Het
Styxl1 T C 5: 135,757,122 Y23C probably damaging Het
Tbc1d24 A G 17: 24,206,872 V490A possibly damaging Het
Tbpl2 A T 2: 24,094,732 F133L probably benign Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tnfrsf22 T C 7: 143,638,389 probably benign Het
Top2b A G 14: 16,398,916 E512G probably damaging Het
Ttc17 T A 2: 94,364,345 H561L probably benign Het
Ttll4 G T 1: 74,685,368 V566L possibly damaging Het
Ubqlnl A G 7: 104,148,485 Y602H probably benign Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Wbp11 A G 6: 136,820,585 S279P probably damaging Het
Wdr6 A G 9: 108,576,534 L50P probably damaging Het
Zfp715 A C 7: 43,298,649 I629S possibly damaging Het
Other mutations in Fsd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Fsd2 APN 7 81553007 missense probably benign 0.15
IGL02012:Fsd2 APN 7 81549914 missense probably benign 0.00
IGL02061:Fsd2 APN 7 81540424 nonsense probably null
IGL02971:Fsd2 APN 7 81548923 nonsense probably null
IGL03207:Fsd2 APN 7 81559170 missense probably benign 0.28
IGL03344:Fsd2 APN 7 81559909 missense probably benign 0.00
R0142:Fsd2 UTSW 7 81559935 missense probably damaging 0.98
R0540:Fsd2 UTSW 7 81545017 missense probably damaging 1.00
R0607:Fsd2 UTSW 7 81545017 missense probably damaging 1.00
R0846:Fsd2 UTSW 7 81540397 missense probably benign 0.00
R0863:Fsd2 UTSW 7 81542165 missense possibly damaging 0.47
R1172:Fsd2 UTSW 7 81559770 missense probably benign
R1173:Fsd2 UTSW 7 81559770 missense probably benign
R1175:Fsd2 UTSW 7 81559770 missense probably benign
R1438:Fsd2 UTSW 7 81548873 missense probably benign 0.13
R1456:Fsd2 UTSW 7 81559591 nonsense probably null
R1717:Fsd2 UTSW 7 81535109 missense probably benign 0.23
R2698:Fsd2 UTSW 7 81545860 missense probably damaging 0.99
R4108:Fsd2 UTSW 7 81544967 missense probably benign 0.01
R4165:Fsd2 UTSW 7 81545860 missense probably damaging 0.99
R4335:Fsd2 UTSW 7 81542065 missense probably damaging 0.99
R4570:Fsd2 UTSW 7 81559770 missense probably benign
R4707:Fsd2 UTSW 7 81559680 missense probably damaging 1.00
R4741:Fsd2 UTSW 7 81551895 critical splice donor site probably null
R4863:Fsd2 UTSW 7 81552964 missense probably null 0.91
R5281:Fsd2 UTSW 7 81552985 missense probably benign 0.15
R5898:Fsd2 UTSW 7 81537227 missense probably damaging 1.00
R6812:Fsd2 UTSW 7 81535089 missense probably benign 0.00
R7367:Fsd2 UTSW 7 81535180 missense probably damaging 1.00
Z1176:Fsd2 UTSW 7 81553192 missense probably damaging 1.00
Z1177:Fsd2 UTSW 7 81559752 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGCCTGTAGGTTTTATTCCC -3'
(R):5'- TCCTTCTTACGGGATGAGGAG -3'

Sequencing Primer
(F):5'- CTGTCCACCTCCCTGAGACATAC -3'
(R):5'- TTCTTACGGGATGAGGAGGAGGG -3'
Posted On2014-08-25