Incidental Mutation 'R2014:Polq'
ID 222667
Institutional Source Beutler Lab
Gene Symbol Polq
Ensembl Gene ENSMUSG00000034206
Gene Name polymerase (DNA directed), theta
Synonyms A430110D14Rik
MMRRC Submission 040023-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.492) question?
Stock # R2014 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 36832148-36915779 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36898728 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 2163 (T2163A)
Ref Sequence ENSEMBL: ENSMUSP00000059757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]
AlphaFold Q8CGS6
Predicted Effect probably damaging
Transcript: ENSMUST00000054034
AA Change: T2163A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: T2163A

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
DEXDc 87 298 4.09e-18 SMART
HELICc 398 484 4.02e-17 SMART
Blast:DEXDc 485 550 2e-25 BLAST
low complexity region 609 626 N/A INTRINSIC
PDB:2ZJA|A 712 826 5e-9 PDB
low complexity region 845 852 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
low complexity region 1126 1149 N/A INTRINSIC
low complexity region 1813 1822 N/A INTRINSIC
POLAc 2265 2504 3.3e-101 SMART
low complexity region 2521 2531 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000071452
AA Change: T1884A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: T1884A

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 216 5.9e-12 PFAM
low complexity region 330 347 N/A INTRINSIC
PDB:2ZJA|A 433 547 5e-9 PDB
low complexity region 566 573 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 847 870 N/A INTRINSIC
low complexity region 1534 1543 N/A INTRINSIC
POLAc 1986 2225 3.3e-101 SMART
low complexity region 2242 2252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182946
SMART Domains Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183112
SMART Domains Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Meta Mutation Damage Score 0.4032 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (105/109)
MGI Phenotype PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T G 17: 48,347,723 (GRCm39) T194P possibly damaging Het
Aadacl4fm5 A T 4: 144,506,295 (GRCm39) L132Q probably damaging Het
Acsbg2 T A 17: 57,160,855 (GRCm39) K263M possibly damaging Het
Adcy8 C T 15: 64,639,727 (GRCm39) G678S probably benign Het
Adgrl2 C T 3: 148,532,111 (GRCm39) G1041R probably damaging Het
Ahnak T C 19: 8,990,545 (GRCm39) I3943T probably damaging Het
Aire T C 10: 77,878,792 (GRCm39) D85G probably damaging Het
Alkbh8 C T 9: 3,343,216 (GRCm39) Q36* probably null Het
Amer3 T C 1: 34,618,525 (GRCm39) probably benign Het
Angptl8 T C 9: 21,748,358 (GRCm39) probably null Het
Ankmy1 T C 1: 92,812,863 (GRCm39) D482G probably benign Het
Apc A G 18: 34,448,644 (GRCm39) I1813V probably damaging Het
Asb13 T G 13: 3,699,512 (GRCm39) probably null Het
Blm T C 7: 80,152,147 (GRCm39) E600G probably damaging Het
Cd163 G T 6: 124,302,457 (GRCm39) W1007L probably damaging Het
Cdr1 A G X: 60,228,420 (GRCm39) F249L probably benign Het
Cp A G 3: 20,041,598 (GRCm39) K44E probably benign Het
Crtap C A 9: 114,210,653 (GRCm39) probably null Het
Ctsk A G 3: 95,414,003 (GRCm39) D250G probably damaging Het
Dcp2 T C 18: 44,543,363 (GRCm39) V307A probably benign Het
Dnah6 T A 6: 73,150,402 (GRCm39) D787V probably damaging Het
Dtx3l G A 16: 35,756,797 (GRCm39) H129Y probably benign Het
Ece2 A G 16: 20,461,067 (GRCm39) T442A probably benign Het
Espl1 C T 15: 102,231,149 (GRCm39) R17* probably null Het
Espn G T 4: 152,217,416 (GRCm39) probably null Het
Fam20b C T 1: 156,533,511 (GRCm39) R35Q possibly damaging Het
Fga A G 3: 82,940,064 (GRCm39) I573V probably damaging Het
Fmo5 A G 3: 97,542,998 (GRCm39) K103E possibly damaging Het
Frem1 A T 4: 82,924,089 (GRCm39) V291D probably damaging Het
Gabbr1 A G 17: 37,367,674 (GRCm39) probably null Het
Gjb6 T C 14: 57,362,213 (GRCm39) H16R probably damaging Het
Grina T C 15: 76,132,734 (GRCm39) V167A probably damaging Het
Gulo T A 14: 66,246,496 (GRCm39) M1L probably benign Het
Hcfc2 A G 10: 82,574,814 (GRCm39) N618D probably benign Het
Heatr5b T C 17: 79,121,613 (GRCm39) D704G probably damaging Het
Hlcs A G 16: 94,063,599 (GRCm39) V487A probably benign Het
Hps1 G A 19: 42,750,951 (GRCm39) P350S probably benign Het
Hspa9 A T 18: 35,079,701 (GRCm39) Y243N probably damaging Het
Igll1 A G 16: 16,681,639 (GRCm39) S39P probably benign Het
Kif21b T C 1: 136,076,020 (GRCm39) F270L probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt27 A G 11: 99,240,318 (GRCm39) V200A probably benign Het
Lama3 T C 18: 12,657,778 (GRCm39) probably benign Het
Lmcd1 T C 6: 112,305,702 (GRCm39) W268R probably damaging Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Mamdc4 T A 2: 25,453,584 (GRCm39) D1195V probably damaging Het
Map2 T C 1: 66,455,295 (GRCm39) V1395A possibly damaging Het
Map3k20 C T 2: 72,268,604 (GRCm39) T537M probably benign Het
Mdga1 A G 17: 30,068,287 (GRCm39) S276P probably damaging Het
Mep1a T C 17: 43,808,797 (GRCm39) N85D probably benign Het
Mettl16 A G 11: 74,708,195 (GRCm39) S425G probably benign Het
Mthfd1l A G 10: 3,997,894 (GRCm39) T622A probably benign Het
Nbeal2 G A 9: 110,463,139 (GRCm39) L1309F probably benign Het
Nde1 A T 16: 13,987,321 (GRCm39) probably benign Het
Nhsl1 A T 10: 18,387,340 (GRCm39) R205W probably damaging Het
Nlrc5 A G 8: 95,252,138 (GRCm39) probably benign Het
Notch3 C A 17: 32,376,974 (GRCm39) E310D probably benign Het
Or2f1 A G 6: 42,721,784 (GRCm39) E271G probably damaging Het
Or4p19 T C 2: 88,242,388 (GRCm39) T205A probably benign Het
Or5ak24 T A 2: 85,260,696 (GRCm39) H159L possibly damaging Het
Or7a39 T C 10: 78,715,222 (GRCm39) I72T possibly damaging Het
Osbpl5 C A 7: 143,295,429 (GRCm39) C11F probably damaging Het
P4hb T C 11: 120,453,522 (GRCm39) E381G probably damaging Het
Pax4 A G 6: 28,446,209 (GRCm39) Y95H probably benign Het
Pdia3 T C 2: 121,265,301 (GRCm39) V390A probably damaging Het
Pigv A C 4: 133,390,034 (GRCm39) D49E possibly damaging Het
Pik3c2a T A 7: 115,950,166 (GRCm39) probably null Het
Plxnb1 T A 9: 108,935,687 (GRCm39) probably benign Het
Pou5f2 T C 13: 78,173,972 (GRCm39) S305P probably benign Het
Ppm1h A T 10: 122,756,630 (GRCm39) H425L possibly damaging Het
Ppp1r13b G T 12: 111,800,222 (GRCm39) D518E probably benign Het
Prf1 A T 10: 61,139,674 (GRCm39) D544V probably benign Het
Prl3b1 T C 13: 27,431,948 (GRCm39) F158L probably benign Het
Prss41 C T 17: 24,056,464 (GRCm39) probably null Het
Prune2 T G 19: 17,097,887 (GRCm39) N1130K probably damaging Het
Ptgdr2 T C 19: 10,917,789 (GRCm39) F102S probably damaging Het
Ptprq T G 10: 107,503,283 (GRCm39) K792Q probably damaging Het
Pttg1ip2 T A 5: 5,505,964 (GRCm39) I106L probably benign Het
Rcbtb2 T C 14: 73,411,826 (GRCm39) probably benign Het
Rgs14 C A 13: 55,531,513 (GRCm39) S479* probably null Het
Sash1 A T 10: 8,605,177 (GRCm39) V1071D probably benign Het
Sdsl G A 5: 120,601,218 (GRCm39) T18M probably damaging Het
Sepsecs T A 5: 52,804,966 (GRCm39) Q365L probably benign Het
Sh2d4a A T 8: 68,783,735 (GRCm39) Q223L probably damaging Het
Slc14a2 T C 18: 78,193,601 (GRCm39) probably benign Het
Slc5a9 A C 4: 111,753,546 (GRCm39) S52A possibly damaging Het
Slc6a18 C A 13: 73,823,844 (GRCm39) V99L probably benign Het
Smarca2 T C 19: 26,661,305 (GRCm39) S967P possibly damaging Het
Tbc1d22a C T 15: 86,183,885 (GRCm39) T248M probably damaging Het
Tcte1 A T 17: 45,852,237 (GRCm39) N490I probably benign Het
Tet3 T C 6: 83,363,057 (GRCm39) E705G probably damaging Het
Tfeb T A 17: 48,102,484 (GRCm39) H450Q probably damaging Het
Tmem248 G A 5: 130,260,653 (GRCm39) E73K probably damaging Het
Trip12 A T 1: 84,738,587 (GRCm39) L756* probably null Het
Try5 C T 6: 41,291,585 (GRCm39) probably null Het
Tsc1 A T 2: 28,555,649 (GRCm39) probably benign Het
Tspear G A 10: 77,710,954 (GRCm39) probably benign Het
Ttc6 T C 12: 57,623,003 (GRCm39) I134T possibly damaging Het
Ttn T A 2: 76,585,640 (GRCm39) probably null Het
Ube3b A G 5: 114,549,210 (GRCm39) E738G probably damaging Het
Usp36 T C 11: 118,153,334 (GRCm39) probably benign Het
Vmn2r71 T A 7: 85,269,845 (GRCm39) M452K probably benign Het
Vps13b T C 15: 35,607,288 (GRCm39) S1074P probably damaging Het
Vps13d A G 4: 144,835,078 (GRCm39) S2757P probably damaging Het
Vwde C A 6: 13,208,337 (GRCm39) G182C possibly damaging Het
Wdr33 T C 18: 31,966,652 (GRCm39) V164A probably damaging Het
Zkscan16 A G 4: 58,956,525 (GRCm39) Y269C possibly damaging Het
Zup1 A G 10: 33,805,820 (GRCm39) V437A possibly damaging Het
Other mutations in Polq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Polq APN 16 36,885,609 (GRCm39) splice site probably benign
IGL00539:Polq APN 16 36,880,931 (GRCm39) missense probably damaging 0.98
IGL00960:Polq APN 16 36,880,874 (GRCm39) missense probably damaging 0.96
IGL01100:Polq APN 16 36,881,474 (GRCm39) missense probably benign
IGL01112:Polq APN 16 36,837,671 (GRCm39) missense probably damaging 1.00
IGL01138:Polq APN 16 36,866,231 (GRCm39) missense possibly damaging 0.94
IGL01432:Polq APN 16 36,892,184 (GRCm39) splice site probably benign
IGL01522:Polq APN 16 36,848,265 (GRCm39) missense probably damaging 1.00
IGL01565:Polq APN 16 36,833,475 (GRCm39) missense probably benign 0.00
IGL01592:Polq APN 16 36,855,212 (GRCm39) missense probably benign 0.01
IGL01690:Polq APN 16 36,883,200 (GRCm39) missense probably damaging 0.97
IGL01943:Polq APN 16 36,881,805 (GRCm39) missense possibly damaging 0.47
IGL02531:Polq APN 16 36,882,736 (GRCm39) missense possibly damaging 0.75
IGL02553:Polq APN 16 36,862,130 (GRCm39) missense probably damaging 1.00
IGL02623:Polq APN 16 36,880,737 (GRCm39) missense probably benign 0.04
IGL02692:Polq APN 16 36,880,989 (GRCm39) missense probably damaging 1.00
IGL02717:Polq APN 16 36,843,102 (GRCm39) missense probably damaging 1.00
IGL02937:Polq APN 16 36,833,471 (GRCm39) missense probably benign 0.14
IGL02959:Polq APN 16 36,906,928 (GRCm39) missense probably damaging 1.00
IGL03086:Polq APN 16 36,911,411 (GRCm39) missense probably benign 0.02
IGL03141:Polq APN 16 36,837,720 (GRCm39) splice site probably benign
IGL03302:Polq APN 16 36,892,134 (GRCm39) missense probably damaging 1.00
IGL03393:Polq APN 16 36,865,156 (GRCm39) missense probably damaging 1.00
R0013_Polq_667 UTSW 16 36,882,201 (GRCm39) missense possibly damaging 0.56
R4238_Polq_233 UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4280_polq_867 UTSW 16 36,902,419 (GRCm39) missense probably damaging 1.00
G1Funyon:Polq UTSW 16 36,882,181 (GRCm39) missense probably damaging 1.00
PIT4403001:Polq UTSW 16 36,880,949 (GRCm39) missense probably benign 0.00
R0013:Polq UTSW 16 36,882,201 (GRCm39) missense possibly damaging 0.56
R0082:Polq UTSW 16 36,837,619 (GRCm39) missense probably benign 0.01
R0212:Polq UTSW 16 36,887,216 (GRCm39) missense probably damaging 0.99
R0387:Polq UTSW 16 36,909,679 (GRCm39) missense probably damaging 1.00
R0387:Polq UTSW 16 36,849,792 (GRCm39) missense probably damaging 1.00
R0427:Polq UTSW 16 36,882,355 (GRCm39) nonsense probably null
R0454:Polq UTSW 16 36,855,252 (GRCm39) missense probably damaging 0.98
R0513:Polq UTSW 16 36,914,864 (GRCm39) missense probably damaging 1.00
R0622:Polq UTSW 16 36,881,355 (GRCm39) missense probably benign 0.02
R0848:Polq UTSW 16 36,882,492 (GRCm39) missense probably benign 0.08
R1142:Polq UTSW 16 36,833,579 (GRCm39) missense probably damaging 0.98
R1218:Polq UTSW 16 36,849,808 (GRCm39) missense possibly damaging 0.93
R1331:Polq UTSW 16 36,862,109 (GRCm39) missense probably damaging 1.00
R1398:Polq UTSW 16 36,882,857 (GRCm39) missense possibly damaging 0.87
R1424:Polq UTSW 16 36,906,890 (GRCm39) missense probably damaging 1.00
R1644:Polq UTSW 16 36,880,626 (GRCm39) missense probably damaging 0.96
R1777:Polq UTSW 16 36,880,586 (GRCm39) missense possibly damaging 0.94
R1820:Polq UTSW 16 36,849,780 (GRCm39) missense possibly damaging 0.48
R1854:Polq UTSW 16 36,882,471 (GRCm39) missense probably benign 0.01
R1880:Polq UTSW 16 36,906,954 (GRCm39) missense possibly damaging 0.90
R1932:Polq UTSW 16 36,882,666 (GRCm39) missense possibly damaging 0.92
R2008:Polq UTSW 16 36,882,844 (GRCm39) missense probably damaging 0.96
R2026:Polq UTSW 16 36,883,107 (GRCm39) missense possibly damaging 0.93
R2178:Polq UTSW 16 36,883,191 (GRCm39) missense probably damaging 1.00
R2259:Polq UTSW 16 36,882,459 (GRCm39) missense probably benign 0.03
R2266:Polq UTSW 16 36,882,515 (GRCm39) missense possibly damaging 0.59
R2305:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R2370:Polq UTSW 16 36,894,301 (GRCm39) missense probably damaging 1.00
R2504:Polq UTSW 16 36,832,304 (GRCm39) missense unknown
R2517:Polq UTSW 16 36,909,687 (GRCm39) missense probably damaging 1.00
R2697:Polq UTSW 16 36,862,515 (GRCm39) missense probably damaging 1.00
R2858:Polq UTSW 16 36,883,115 (GRCm39) missense possibly damaging 0.88
R3436:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R3437:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R3699:Polq UTSW 16 36,862,518 (GRCm39) missense probably damaging 1.00
R3838:Polq UTSW 16 36,898,711 (GRCm39) missense probably damaging 1.00
R3875:Polq UTSW 16 36,894,389 (GRCm39) missense probably damaging 0.99
R4050:Polq UTSW 16 36,913,182 (GRCm39) critical splice acceptor site probably null
R4172:Polq UTSW 16 36,881,120 (GRCm39) missense probably benign 0.02
R4238:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4240:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4280:Polq UTSW 16 36,902,419 (GRCm39) missense probably damaging 1.00
R4296:Polq UTSW 16 36,881,663 (GRCm39) missense possibly damaging 0.94
R4360:Polq UTSW 16 36,880,701 (GRCm39) missense probably benign 0.00
R4373:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4375:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4376:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4509:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4510:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4511:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4543:Polq UTSW 16 36,881,147 (GRCm39) missense probably benign 0.43
R4633:Polq UTSW 16 36,868,904 (GRCm39) missense probably damaging 1.00
R4739:Polq UTSW 16 36,862,109 (GRCm39) missense probably damaging 1.00
R4834:Polq UTSW 16 36,848,176 (GRCm39) missense probably damaging 1.00
R4841:Polq UTSW 16 36,869,145 (GRCm39) critical splice donor site probably null
R4842:Polq UTSW 16 36,869,145 (GRCm39) critical splice donor site probably null
R4937:Polq UTSW 16 36,848,274 (GRCm39) missense probably benign 0.01
R4955:Polq UTSW 16 36,881,444 (GRCm39) missense probably benign 0.32
R4992:Polq UTSW 16 36,881,524 (GRCm39) missense possibly damaging 0.59
R5008:Polq UTSW 16 36,882,749 (GRCm39) missense probably benign
R5221:Polq UTSW 16 36,862,540 (GRCm39) missense probably damaging 0.98
R5254:Polq UTSW 16 36,909,681 (GRCm39) missense probably damaging 1.00
R5292:Polq UTSW 16 36,881,745 (GRCm39) missense probably damaging 1.00
R5375:Polq UTSW 16 36,903,146 (GRCm39) missense probably damaging 1.00
R5480:Polq UTSW 16 36,833,652 (GRCm39) splice site probably benign
R5552:Polq UTSW 16 36,914,872 (GRCm39) missense possibly damaging 0.93
R5591:Polq UTSW 16 36,832,247 (GRCm39) utr 5 prime probably benign
R5653:Polq UTSW 16 36,860,896 (GRCm39) missense probably damaging 1.00
R5708:Polq UTSW 16 36,881,380 (GRCm39) missense probably damaging 0.98
R5754:Polq UTSW 16 36,837,625 (GRCm39) missense probably benign
R5757:Polq UTSW 16 36,907,043 (GRCm39) missense probably benign 0.01
R5764:Polq UTSW 16 36,837,706 (GRCm39) missense probably damaging 0.97
R6019:Polq UTSW 16 36,882,126 (GRCm39) missense probably damaging 1.00
R6170:Polq UTSW 16 36,866,174 (GRCm39) missense possibly damaging 0.82
R6177:Polq UTSW 16 36,892,071 (GRCm39) missense probably damaging 0.98
R6307:Polq UTSW 16 36,837,718 (GRCm39) critical splice donor site probably null
R6499:Polq UTSW 16 36,881,189 (GRCm39) missense probably benign 0.03
R6520:Polq UTSW 16 36,880,739 (GRCm39) missense possibly damaging 0.88
R6598:Polq UTSW 16 36,881,993 (GRCm39) missense probably benign 0.39
R6694:Polq UTSW 16 36,835,535 (GRCm39) missense probably null 0.99
R6788:Polq UTSW 16 36,897,510 (GRCm39) missense probably damaging 1.00
R7104:Polq UTSW 16 36,909,715 (GRCm39) nonsense probably null
R7159:Polq UTSW 16 36,883,215 (GRCm39) missense possibly damaging 0.87
R7222:Polq UTSW 16 36,906,995 (GRCm39) nonsense probably null
R7340:Polq UTSW 16 36,881,288 (GRCm39) missense probably benign 0.00
R7361:Polq UTSW 16 36,880,790 (GRCm39) missense probably benign 0.00
R7384:Polq UTSW 16 36,849,780 (GRCm39) missense probably damaging 1.00
R7509:Polq UTSW 16 36,880,706 (GRCm39) missense probably benign 0.00
R7509:Polq UTSW 16 36,880,705 (GRCm39) missense probably benign
R7575:Polq UTSW 16 36,911,496 (GRCm39) missense probably benign 0.00
R7785:Polq UTSW 16 36,848,239 (GRCm39) missense probably damaging 1.00
R7787:Polq UTSW 16 36,837,671 (GRCm39) missense probably damaging 1.00
R7891:Polq UTSW 16 36,848,244 (GRCm39) missense probably damaging 1.00
R7898:Polq UTSW 16 36,865,245 (GRCm39) missense probably damaging 0.98
R7917:Polq UTSW 16 36,885,650 (GRCm39) missense probably benign 0.08
R7940:Polq UTSW 16 36,881,004 (GRCm39) missense probably benign 0.27
R8028:Polq UTSW 16 36,881,678 (GRCm39) missense possibly damaging 0.82
R8114:Polq UTSW 16 36,862,577 (GRCm39) missense possibly damaging 0.94
R8144:Polq UTSW 16 36,849,846 (GRCm39) missense probably benign 0.01
R8288:Polq UTSW 16 36,848,272 (GRCm39) missense probably damaging 1.00
R8301:Polq UTSW 16 36,882,181 (GRCm39) missense probably damaging 1.00
R8341:Polq UTSW 16 36,892,133 (GRCm39) missense possibly damaging 0.96
R8348:Polq UTSW 16 36,837,559 (GRCm39) critical splice acceptor site probably null
R8448:Polq UTSW 16 36,837,559 (GRCm39) critical splice acceptor site probably null
R8815:Polq UTSW 16 36,853,893 (GRCm39) missense probably damaging 1.00
R8843:Polq UTSW 16 36,832,280 (GRCm39) missense unknown
R8878:Polq UTSW 16 36,860,869 (GRCm39) missense probably benign 0.02
R9016:Polq UTSW 16 36,843,159 (GRCm39) missense probably damaging 1.00
R9189:Polq UTSW 16 36,865,265 (GRCm39) missense probably damaging 1.00
R9209:Polq UTSW 16 36,869,011 (GRCm39) missense possibly damaging 0.94
R9352:Polq UTSW 16 36,862,252 (GRCm39) missense probably damaging 0.98
R9398:Polq UTSW 16 36,881,394 (GRCm39) missense probably benign 0.02
R9403:Polq UTSW 16 36,882,215 (GRCm39) missense probably benign 0.00
R9489:Polq UTSW 16 36,843,173 (GRCm39) missense probably benign 0.00
R9605:Polq UTSW 16 36,843,173 (GRCm39) missense probably benign 0.00
R9664:Polq UTSW 16 36,848,176 (GRCm39) missense probably damaging 0.98
R9801:Polq UTSW 16 36,913,190 (GRCm39) missense probably damaging 1.00
X0060:Polq UTSW 16 36,837,599 (GRCm39) nonsense probably null
Z1176:Polq UTSW 16 36,862,619 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACACCCAGACAATGACAGTTGTG -3'
(R):5'- TGGGTCTCCAGGTCATCACAAG -3'

Sequencing Primer
(F):5'- CCAGACAATGACAGTTGTGGATATAG -3'
(R):5'- GTCATCACAAGCAGACATTACATATG -3'
Posted On 2014-08-25