Incidental Mutation 'R1987:Pnpla6'
ID 222678
Institutional Source Beutler Lab
Gene Symbol Pnpla6
Ensembl Gene ENSMUSG00000004565
Gene Name patatin-like phospholipase domain containing 6
Synonyms Nte, Swiss-cheese, MSws
MMRRC Submission 039999-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1987 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 3565384-3594267 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 3592370 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1209 (T1209S)
Ref Sequence ENSEMBL: ENSMUSP00000146555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004681] [ENSMUST00000111070] [ENSMUST00000207421] [ENSMUST00000208002] [ENSMUST00000207941]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000004681
AA Change: T1220S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000004681
Gene: ENSMUSG00000004565
AA Change: T1220S

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111070
AA Change: T1220S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106699
Gene: ENSMUSG00000004565
AA Change: T1220S

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 1.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207317
Predicted Effect unknown
Transcript: ENSMUST00000207336
AA Change: T137S
Predicted Effect probably benign
Transcript: ENSMUST00000207421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207929
Predicted Effect probably benign
Transcript: ENSMUST00000208002
AA Change: T1238S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000207941
AA Change: T1209S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208851
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase that deacetylates intracellular phosphatidylcholine to produce glycerophosphocholine. It is thought to function in neurite outgrowth and process elongation during neuronal differentiation. The protein is anchored to the cytoplasmic face of the endoplasmic reticulum in both neurons and non-neuronal cells. Mutations in this gene result in autosomal recessive spastic paraplegia, and the protein is the target for neurodegeneration induced by organophosphorus compounds and chemical warfare agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during early gestation. Conditional inactivation in the central nervous system leads to neurodegeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 8,992,615 (GRCm39) D4633V probably damaging Het
Akap6 T C 12: 53,187,578 (GRCm39) F1664S possibly damaging Het
Arhgef28 T C 13: 98,103,604 (GRCm39) M803V probably benign Het
Bltp1 T A 3: 37,008,134 (GRCm39) probably null Het
Bltp2 A T 11: 78,158,993 (GRCm39) Q433L probably damaging Het
Ccdc73 T A 2: 104,761,390 (GRCm39) L130* probably null Het
Ccdc73 A G 2: 104,829,504 (GRCm39) E1059G probably damaging Het
Ccer2 A C 7: 28,456,708 (GRCm39) S151R possibly damaging Het
Cep128 T A 12: 91,197,603 (GRCm39) H406L probably benign Het
Cep135 A G 5: 76,745,275 (GRCm39) D229G probably benign Het
Cpvl T A 6: 53,931,596 (GRCm39) D103V probably benign Het
Crppa T A 12: 36,571,995 (GRCm39) L301Q probably damaging Het
Cstdc6 C A 16: 36,142,194 (GRCm39) G61C probably damaging Het
Disp3 G A 4: 148,343,210 (GRCm39) A567V probably damaging Het
Dnah5 T C 15: 28,343,737 (GRCm39) I2379T probably damaging Het
Dnah6 T C 6: 73,072,027 (GRCm39) Y2433C probably damaging Het
Dock3 A G 9: 106,985,620 (GRCm39) I85T probably benign Het
Dock9 A C 14: 121,829,242 (GRCm39) S1380A probably benign Het
Erbin T C 13: 104,022,711 (GRCm39) T43A probably benign Het
Fastkd3 T C 13: 68,733,360 (GRCm39) V502A possibly damaging Het
Fn1 T C 1: 71,690,784 (GRCm39) H59R probably damaging Het
Fsd2 A G 7: 81,209,407 (GRCm39) V145A possibly damaging Het
Fzr1 A G 10: 81,206,153 (GRCm39) V178A probably damaging Het
Gnpnat1 T C 14: 45,618,455 (GRCm39) R116G probably damaging Het
Grm7 T A 6: 110,891,472 (GRCm39) V235E probably damaging Het
Hdac4 A C 1: 91,862,367 (GRCm39) N1002K probably damaging Het
Hey1 C T 3: 8,729,957 (GRCm39) A167T probably benign Het
Hrnr A G 3: 93,239,911 (GRCm39) N3383S unknown Het
Ints2 A T 11: 86,108,626 (GRCm39) V907D probably benign Het
Jchain T A 5: 88,669,326 (GRCm39) Q109L probably damaging Het
Klhdc7a A T 4: 139,693,335 (GRCm39) Y537* probably null Het
Klra1 C T 6: 130,354,742 (GRCm39) S92N probably benign Het
Krt31 C T 11: 99,940,406 (GRCm39) G150S probably benign Het
Lrrc71 G A 3: 87,649,950 (GRCm39) T326M probably benign Het
Lrrn4 T C 2: 132,712,363 (GRCm39) T487A probably benign Het
Map4k5 T G 12: 69,889,686 (GRCm39) R198S probably damaging Het
Men1 G A 19: 6,388,867 (GRCm39) C354Y probably damaging Het
Ms4a18 A T 19: 10,991,019 (GRCm39) V25E probably damaging Het
Mutyh T A 4: 116,676,565 (GRCm39) S512R possibly damaging Het
Myh10 G T 11: 68,705,322 (GRCm39) A1947S possibly damaging Het
Nfasc T C 1: 132,538,624 (GRCm39) D427G probably damaging Het
Nlrp9c A G 7: 26,077,481 (GRCm39) M767T probably benign Het
Nrbp1 T C 5: 31,402,735 (GRCm39) L185P probably damaging Het
Pcdh9 G A 14: 94,125,741 (GRCm39) P143L probably damaging Het
Pcsk6 A T 7: 65,577,035 (GRCm39) M158L possibly damaging Het
Pkd1 G T 17: 24,795,566 (GRCm39) probably null Het
Plk4 A T 3: 40,760,252 (GRCm39) S383C possibly damaging Het
Plxna2 T C 1: 194,326,297 (GRCm39) L77P probably damaging Het
Prdm2 A G 4: 142,859,079 (GRCm39) S1404P possibly damaging Het
Preb T C 5: 31,116,157 (GRCm39) D150G probably damaging Het
Prrt2 A G 7: 126,617,902 (GRCm39) V59A probably benign Het
Prss40 T C 1: 34,597,095 (GRCm39) N151S possibly damaging Het
Ptprt G T 2: 161,400,818 (GRCm39) A1053D probably damaging Het
Ptprt A G 2: 161,608,241 (GRCm39) V685A possibly damaging Het
Rfx4 C T 10: 84,731,952 (GRCm39) S549F possibly damaging Het
Rnaset2b T A 17: 7,263,876 (GRCm39) V87E probably benign Het
Rnf213 G A 11: 119,331,933 (GRCm39) E2381K probably damaging Het
Sectm1a A T 11: 120,960,506 (GRCm39) I103N probably damaging Het
Selp T A 1: 163,970,327 (GRCm39) L597Q probably damaging Het
Sema6a T C 18: 47,433,209 (GRCm39) D74G probably damaging Het
Serpinb9b T C 13: 33,213,542 (GRCm39) V33A probably benign Het
Setd1b A T 5: 123,285,769 (GRCm39) T272S unknown Het
Sgf29 G C 7: 126,248,649 (GRCm39) probably null Het
Slc4a10 C A 2: 62,098,548 (GRCm39) Q561K probably damaging Het
Slc4a5 T C 6: 83,250,214 (GRCm39) I649T possibly damaging Het
Slc5a7 A G 17: 54,600,863 (GRCm39) Y91H probably damaging Het
Styxl1 T C 5: 135,785,976 (GRCm39) Y23C probably damaging Het
Tbc1d24 A G 17: 24,425,846 (GRCm39) V490A possibly damaging Het
Tbpl2 A T 2: 23,984,744 (GRCm39) F133L probably benign Het
Tnfrsf22 T C 7: 143,192,126 (GRCm39) probably benign Het
Top2b A G 14: 16,398,916 (GRCm38) E512G probably damaging Het
Trgc3 C A 13: 19,445,164 (GRCm39) F37L probably damaging Het
Ttc17 T A 2: 94,194,690 (GRCm39) H561L probably benign Het
Ttll4 G T 1: 74,724,527 (GRCm39) V566L possibly damaging Het
Ubqlnl A G 7: 103,797,692 (GRCm39) Y602H probably benign Het
Vmn1r231 T A 17: 21,110,212 (GRCm39) E234D probably damaging Het
Wbp11 A G 6: 136,797,583 (GRCm39) S279P probably damaging Het
Wdr6 A G 9: 108,453,733 (GRCm39) L50P probably damaging Het
Zfp715 A C 7: 42,948,073 (GRCm39) I629S possibly damaging Het
Other mutations in Pnpla6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pnpla6 APN 8 3,573,808 (GRCm39) missense probably damaging 1.00
IGL00820:Pnpla6 APN 8 3,582,358 (GRCm39) missense possibly damaging 0.95
IGL00839:Pnpla6 APN 8 3,592,299 (GRCm39) missense probably benign 0.05
IGL01732:Pnpla6 APN 8 3,572,616 (GRCm39) missense probably damaging 0.99
IGL01973:Pnpla6 APN 8 3,567,619 (GRCm39) missense probably damaging 1.00
IGL02267:Pnpla6 APN 8 3,567,327 (GRCm39) missense probably benign 0.00
IGL03246:Pnpla6 APN 8 3,581,530 (GRCm39) missense probably benign 0.01
IGL03286:Pnpla6 APN 8 3,581,473 (GRCm39) missense probably damaging 0.99
Immemorial UTSW 8 3,581,677 (GRCm39) missense probably benign 0.38
Mammilary UTSW 8 3,571,384 (GRCm39) missense probably benign 0.01
I0000:Pnpla6 UTSW 8 3,592,322 (GRCm39) missense probably benign
R0141:Pnpla6 UTSW 8 3,582,117 (GRCm39) critical splice donor site probably null
R0180:Pnpla6 UTSW 8 3,574,250 (GRCm39) critical splice acceptor site probably null
R0377:Pnpla6 UTSW 8 3,591,501 (GRCm39) missense probably damaging 1.00
R0563:Pnpla6 UTSW 8 3,573,333 (GRCm39) missense possibly damaging 0.51
R0660:Pnpla6 UTSW 8 3,572,269 (GRCm39) unclassified probably benign
R0786:Pnpla6 UTSW 8 3,573,317 (GRCm39) missense probably benign
R0827:Pnpla6 UTSW 8 3,567,618 (GRCm39) missense possibly damaging 0.71
R0882:Pnpla6 UTSW 8 3,567,081 (GRCm39) missense probably damaging 1.00
R1512:Pnpla6 UTSW 8 3,585,459 (GRCm39) splice site probably benign
R1552:Pnpla6 UTSW 8 3,572,403 (GRCm39) missense probably damaging 1.00
R1609:Pnpla6 UTSW 8 3,567,135 (GRCm39) missense probably damaging 1.00
R1770:Pnpla6 UTSW 8 3,584,634 (GRCm39) missense possibly damaging 0.94
R1779:Pnpla6 UTSW 8 3,591,404 (GRCm39) missense probably damaging 1.00
R3079:Pnpla6 UTSW 8 3,591,512 (GRCm39) missense probably benign 0.25
R3125:Pnpla6 UTSW 8 3,584,670 (GRCm39) missense probably null 1.00
R4171:Pnpla6 UTSW 8 3,593,997 (GRCm39) missense probably benign 0.09
R4281:Pnpla6 UTSW 8 3,571,513 (GRCm39) missense probably damaging 1.00
R4674:Pnpla6 UTSW 8 3,571,412 (GRCm39) missense probably damaging 1.00
R4776:Pnpla6 UTSW 8 3,573,818 (GRCm39) missense probably benign 0.01
R4779:Pnpla6 UTSW 8 3,572,838 (GRCm39) missense probably benign 0.00
R5114:Pnpla6 UTSW 8 3,572,613 (GRCm39) missense probably damaging 0.98
R5459:Pnpla6 UTSW 8 3,585,829 (GRCm39) missense probably benign 0.01
R5510:Pnpla6 UTSW 8 3,571,397 (GRCm39) missense probably damaging 0.99
R5538:Pnpla6 UTSW 8 3,581,508 (GRCm39) missense probably benign 0.01
R5664:Pnpla6 UTSW 8 3,587,478 (GRCm39) missense probably damaging 0.98
R6063:Pnpla6 UTSW 8 3,574,156 (GRCm39) missense probably benign 0.21
R6314:Pnpla6 UTSW 8 3,571,572 (GRCm39) missense probably benign 0.39
R6321:Pnpla6 UTSW 8 3,594,015 (GRCm39) missense probably benign
R6454:Pnpla6 UTSW 8 3,587,986 (GRCm39) missense probably damaging 0.99
R6477:Pnpla6 UTSW 8 3,586,627 (GRCm39) missense probably benign 0.00
R6524:Pnpla6 UTSW 8 3,584,519 (GRCm39) splice site probably null
R6809:Pnpla6 UTSW 8 3,584,611 (GRCm39) missense possibly damaging 0.72
R6975:Pnpla6 UTSW 8 3,588,068 (GRCm39) missense probably damaging 1.00
R7293:Pnpla6 UTSW 8 3,588,068 (GRCm39) missense probably damaging 1.00
R7389:Pnpla6 UTSW 8 3,593,981 (GRCm39) nonsense probably null
R7426:Pnpla6 UTSW 8 3,566,540 (GRCm39) splice site probably null
R7520:Pnpla6 UTSW 8 3,587,508 (GRCm39) missense probably damaging 1.00
R7666:Pnpla6 UTSW 8 3,591,591 (GRCm39) missense probably benign 0.01
R7733:Pnpla6 UTSW 8 3,572,660 (GRCm39) missense probably benign 0.01
R7743:Pnpla6 UTSW 8 3,586,594 (GRCm39) missense possibly damaging 0.77
R7744:Pnpla6 UTSW 8 3,581,677 (GRCm39) missense probably benign 0.38
R7923:Pnpla6 UTSW 8 3,581,737 (GRCm39) nonsense probably null
R7980:Pnpla6 UTSW 8 3,586,562 (GRCm39) missense probably damaging 0.97
R8141:Pnpla6 UTSW 8 3,571,384 (GRCm39) missense probably benign 0.01
R8191:Pnpla6 UTSW 8 3,592,382 (GRCm39) missense probably benign 0.12
R8251:Pnpla6 UTSW 8 3,582,399 (GRCm39) missense probably benign 0.29
R8881:Pnpla6 UTSW 8 3,581,489 (GRCm39) missense probably benign 0.00
R8917:Pnpla6 UTSW 8 3,567,637 (GRCm39) missense possibly damaging 0.50
R8939:Pnpla6 UTSW 8 3,571,319 (GRCm39) missense possibly damaging 0.86
R8988:Pnpla6 UTSW 8 3,567,401 (GRCm39) missense possibly damaging 0.51
R9037:Pnpla6 UTSW 8 3,592,379 (GRCm39) nonsense probably null
R9264:Pnpla6 UTSW 8 3,573,294 (GRCm39) missense probably benign
R9265:Pnpla6 UTSW 8 3,573,294 (GRCm39) missense probably benign
R9386:Pnpla6 UTSW 8 3,571,417 (GRCm39) critical splice donor site probably null
X0018:Pnpla6 UTSW 8 3,567,337 (GRCm39) missense probably damaging 1.00
Z1177:Pnpla6 UTSW 8 3,586,979 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AACTGGAAATCTGTGGGCAG -3'
(R):5'- TCATAGGGGACTCTGAGGTG -3'

Sequencing Primer
(F):5'- GATGTCTGCTCTCCCAGAAGTCAAG -3'
(R):5'- TGGTGCCTGAGACCTGG -3'
Posted On 2014-08-25