Mutagenetix > Incidental Mutation

Incidental Mutation 'R1987:Ints2'

222694

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

039999-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1987 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 86217800 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 907 (V907D)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

AlphaFold

Q80UK8

Predicted Effect

probably benign
Transcript: ENSMUST00000018212
AA Change: V907D

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: V907D

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108039
AA Change: V907D

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: V907D

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134828

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	T	11: 78,268,167	Q433L	probably damaging	Het
4932438A13Rik	T	A	3: 36,953,985		probably null	Het
Ahnak	A	T	19: 9,015,251	D4633V	probably damaging	Het
Akap6	T	C	12: 53,140,795	F1664S	possibly damaging	Het
Arhgef28	T	C	13: 97,967,096	M803V	probably benign	Het
BC117090	C	A	16: 36,321,832	G61C	probably damaging	Het
Ccdc73	T	A	2: 104,931,045	L130*	probably null	Het
Ccdc73	A	G	2: 104,999,159	E1059G	probably damaging	Het
Ccer2	A	C	7: 28,757,283	S151R	possibly damaging	Het
Cep128	T	A	12: 91,230,829	H406L	probably benign	Het
Cep135	A	G	5: 76,597,428	D229G	probably benign	Het
Cpvl	T	A	6: 53,954,611	D103V	probably benign	Het
Disp3	G	A	4: 148,258,753	A567V	probably damaging	Het
Dnah5	T	C	15: 28,343,591	I2379T	probably damaging	Het
Dnah6	T	C	6: 73,095,044	Y2433C	probably damaging	Het
Dock3	A	G	9: 107,108,421	I85T	probably benign	Het
Dock9	A	C	14: 121,591,830	S1380A	probably benign	Het
Erbin	T	C	13: 103,886,203	T43A	probably benign	Het
Fastkd3	T	C	13: 68,585,241	V502A	possibly damaging	Het
Fn1	T	C	1: 71,651,625	H59R	probably damaging	Het
Fsd2	A	G	7: 81,559,659	V145A	possibly damaging	Het
Fzr1	A	G	10: 81,370,319	V178A	probably damaging	Het
Gnpnat1	T	C	14: 45,380,998	R116G	probably damaging	Het
Grm7	T	A	6: 110,914,511	V235E	probably damaging	Het
Hdac4	A	C	1: 91,934,645	N1002K	probably damaging	Het
Hey1	C	T	3: 8,664,897	A167T	probably benign	Het
Hrnr	A	G	3: 93,332,604	N3383S	unknown	Het
Ispd	T	A	12: 36,521,996	L301Q	probably damaging	Het
Jchain	T	A	5: 88,521,467	Q109L	probably damaging	Het
Klhdc7a	A	T	4: 139,966,024	Y537*	probably null	Het
Klra1	C	T	6: 130,377,779	S92N	probably benign	Het
Krt31	C	T	11: 100,049,580	G150S	probably benign	Het
Lrrc71	G	A	3: 87,742,643	T326M	probably benign	Het
Lrrn4	T	C	2: 132,870,443	T487A	probably benign	Het
Map4k5	T	G	12: 69,842,912	R198S	probably damaging	Het
Men1	G	A	19: 6,338,837	C354Y	probably damaging	Het
Ms4a18	A	T	19: 11,013,655	V25E	probably damaging	Het
Mutyh	T	A	4: 116,819,368	S512R	possibly damaging	Het
Myh10	G	T	11: 68,814,496	A1947S	possibly damaging	Het
Nfasc	T	C	1: 132,610,886	D427G	probably damaging	Het
Nlrp9c	A	G	7: 26,378,056	M767T	probably benign	Het
Nrbp1	T	C	5: 31,245,391	L185P	probably damaging	Het
Pcdh9	G	A	14: 93,888,305	P143L	probably damaging	Het
Pcsk6	A	T	7: 65,927,287	M158L	possibly damaging	Het
Pkd1	G	T	17: 24,576,592		probably null	Het
Plk4	A	T	3: 40,805,817	S383C	possibly damaging	Het
Plxna2	T	C	1: 194,643,989	L77P	probably damaging	Het
Pnpla6	A	T	8: 3,542,370	T1209S	probably benign	Het
Prdm2	A	G	4: 143,132,509	S1404P	possibly damaging	Het
Preb	T	C	5: 30,958,813	D150G	probably damaging	Het
Prrt2	A	G	7: 127,018,730	V59A	probably benign	Het
Prss40	T	C	1: 34,558,014	N151S	possibly damaging	Het
Ptprt	G	T	2: 161,558,898	A1053D	probably damaging	Het
Ptprt	A	G	2: 161,766,321	V685A	possibly damaging	Het
Rfx4	C	T	10: 84,896,088	S549F	possibly damaging	Het
Rnaset2b	T	A	17: 6,996,477	V87E	probably benign	Het
Rnf213	G	A	11: 119,441,107	E2381K	probably damaging	Het
Sectm1a	A	T	11: 121,069,680	I103N	probably damaging	Het
Selp	T	A	1: 164,142,758	L597Q	probably damaging	Het
Sema6a	T	C	18: 47,300,142	D74G	probably damaging	Het
Serpinb9b	T	C	13: 33,029,559	V33A	probably benign	Het
Setd1b	A	T	5: 123,147,706	T272S	unknown	Het
Sgf29	G	C	7: 126,649,477		probably null	Het
Slc4a10	C	A	2: 62,268,204	Q561K	probably damaging	Het
Slc4a5	T	C	6: 83,273,232	I649T	possibly damaging	Het
Slc5a7	A	G	17: 54,293,835	Y91H	probably damaging	Het
Styxl1	T	C	5: 135,757,122	Y23C	probably damaging	Het
Tbc1d24	A	G	17: 24,206,872	V490A	possibly damaging	Het
Tbpl2	A	T	2: 24,094,732	F133L	probably benign	Het
Tcrg-C3	C	A	13: 19,260,994	F37L	probably damaging	Het
Tnfrsf22	T	C	7: 143,638,389		probably benign	Het
Top2b	A	G	14: 16,398,916	E512G	probably damaging	Het
Ttc17	T	A	2: 94,364,345	H561L	probably benign	Het
Ttll4	G	T	1: 74,685,368	V566L	possibly damaging	Het
Ubqlnl	A	G	7: 104,148,485	Y602H	probably benign	Het
Vmn1r231	T	A	17: 20,889,950	E234D	probably damaging	Het
Wbp11	A	G	6: 136,820,585	S279P	probably damaging	Het
Wdr6	A	G	9: 108,576,534	L50P	probably damaging	Het
Zfp715	A	C	7: 43,298,649	I629S	possibly damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TATAAGGTCTGTCTCCAACATCC -3'
(R):5'- TCATCATTGTGCGGCATGC -3'

Sequencing Primer
(F):5'- TGCCACACAGGTGTCCAATAATATG -3'
(R):5'- GCGGCATGCATTTCTAGTTC -3'

Posted On

2014-08-25