Mutagenetix > Incidental Mutation

Incidental Mutation 'R1987:Akap6'

222703

Institutional Source

Beutler Lab

Gene Symbol

Akap6

Ensembl Gene

ENSMUSG00000061603

Gene Name

A kinase (PRKA) anchor protein 6

Synonyms

MMRRC Submission

039999-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.729) question?

Stock #

R1987 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52699383-53155599 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53140795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 1664 (F1664S)

Ref Sequence

ENSEMBL: ENSMUSP00000093406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]

AlphaFold

E9Q9K8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095737
AA Change: F1664S

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: F1664S

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
Blast:SPEC	66	168	2e-50	BLAST
low complexity region	441	455	N/A	INTRINSIC
low complexity region	544	555	N/A	INTRINSIC
low complexity region	569	587	N/A	INTRINSIC
low complexity region	640	651	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
SPEC	779	880	1.06e-1	SMART
SPEC	959	1057	1.45e0	SMART
SPEC	1078	1185	2.56e-2	SMART
low complexity region	1316	1332	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1610	1622	N/A	INTRINSIC
low complexity region	1683	1698	N/A	INTRINSIC
low complexity region	1737	1781	N/A	INTRINSIC
low complexity region	1899	1910	N/A	INTRINSIC
low complexity region	2019	2031	N/A	INTRINSIC
low complexity region	2104	2115	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219786

Meta Mutation Damage Score

0.0940

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	T	11: 78,268,167	Q433L	probably damaging	Het
4932438A13Rik	T	A	3: 36,953,985		probably null	Het
Ahnak	A	T	19: 9,015,251	D4633V	probably damaging	Het
Arhgef28	T	C	13: 97,967,096	M803V	probably benign	Het
BC117090	C	A	16: 36,321,832	G61C	probably damaging	Het
Ccdc73	T	A	2: 104,931,045	L130*	probably null	Het
Ccdc73	A	G	2: 104,999,159	E1059G	probably damaging	Het
Ccer2	A	C	7: 28,757,283	S151R	possibly damaging	Het
Cep128	T	A	12: 91,230,829	H406L	probably benign	Het
Cep135	A	G	5: 76,597,428	D229G	probably benign	Het
Cpvl	T	A	6: 53,954,611	D103V	probably benign	Het
Disp3	G	A	4: 148,258,753	A567V	probably damaging	Het
Dnah5	T	C	15: 28,343,591	I2379T	probably damaging	Het
Dnah6	T	C	6: 73,095,044	Y2433C	probably damaging	Het
Dock3	A	G	9: 107,108,421	I85T	probably benign	Het
Dock9	A	C	14: 121,591,830	S1380A	probably benign	Het
Erbin	T	C	13: 103,886,203	T43A	probably benign	Het
Fastkd3	T	C	13: 68,585,241	V502A	possibly damaging	Het
Fn1	T	C	1: 71,651,625	H59R	probably damaging	Het
Fsd2	A	G	7: 81,559,659	V145A	possibly damaging	Het
Fzr1	A	G	10: 81,370,319	V178A	probably damaging	Het
Gnpnat1	T	C	14: 45,380,998	R116G	probably damaging	Het
Grm7	T	A	6: 110,914,511	V235E	probably damaging	Het
Hdac4	A	C	1: 91,934,645	N1002K	probably damaging	Het
Hey1	C	T	3: 8,664,897	A167T	probably benign	Het
Hrnr	A	G	3: 93,332,604	N3383S	unknown	Het
Ints2	A	T	11: 86,217,800	V907D	probably benign	Het
Ispd	T	A	12: 36,521,996	L301Q	probably damaging	Het
Jchain	T	A	5: 88,521,467	Q109L	probably damaging	Het
Klhdc7a	A	T	4: 139,966,024	Y537*	probably null	Het
Klra1	C	T	6: 130,377,779	S92N	probably benign	Het
Krt31	C	T	11: 100,049,580	G150S	probably benign	Het
Lrrc71	G	A	3: 87,742,643	T326M	probably benign	Het
Lrrn4	T	C	2: 132,870,443	T487A	probably benign	Het
Map4k5	T	G	12: 69,842,912	R198S	probably damaging	Het
Men1	G	A	19: 6,338,837	C354Y	probably damaging	Het
Ms4a18	A	T	19: 11,013,655	V25E	probably damaging	Het
Mutyh	T	A	4: 116,819,368	S512R	possibly damaging	Het
Myh10	G	T	11: 68,814,496	A1947S	possibly damaging	Het
Nfasc	T	C	1: 132,610,886	D427G	probably damaging	Het
Nlrp9c	A	G	7: 26,378,056	M767T	probably benign	Het
Nrbp1	T	C	5: 31,245,391	L185P	probably damaging	Het
Pcdh9	G	A	14: 93,888,305	P143L	probably damaging	Het
Pcsk6	A	T	7: 65,927,287	M158L	possibly damaging	Het
Pkd1	G	T	17: 24,576,592		probably null	Het
Plk4	A	T	3: 40,805,817	S383C	possibly damaging	Het
Plxna2	T	C	1: 194,643,989	L77P	probably damaging	Het
Pnpla6	A	T	8: 3,542,370	T1209S	probably benign	Het
Prdm2	A	G	4: 143,132,509	S1404P	possibly damaging	Het
Preb	T	C	5: 30,958,813	D150G	probably damaging	Het
Prrt2	A	G	7: 127,018,730	V59A	probably benign	Het
Prss40	T	C	1: 34,558,014	N151S	possibly damaging	Het
Ptprt	G	T	2: 161,558,898	A1053D	probably damaging	Het
Ptprt	A	G	2: 161,766,321	V685A	possibly damaging	Het
Rfx4	C	T	10: 84,896,088	S549F	possibly damaging	Het
Rnaset2b	T	A	17: 6,996,477	V87E	probably benign	Het
Rnf213	G	A	11: 119,441,107	E2381K	probably damaging	Het
Sectm1a	A	T	11: 121,069,680	I103N	probably damaging	Het
Selp	T	A	1: 164,142,758	L597Q	probably damaging	Het
Sema6a	T	C	18: 47,300,142	D74G	probably damaging	Het
Serpinb9b	T	C	13: 33,029,559	V33A	probably benign	Het
Setd1b	A	T	5: 123,147,706	T272S	unknown	Het
Sgf29	G	C	7: 126,649,477		probably null	Het
Slc4a10	C	A	2: 62,268,204	Q561K	probably damaging	Het
Slc4a5	T	C	6: 83,273,232	I649T	possibly damaging	Het
Slc5a7	A	G	17: 54,293,835	Y91H	probably damaging	Het
Styxl1	T	C	5: 135,757,122	Y23C	probably damaging	Het
Tbc1d24	A	G	17: 24,206,872	V490A	possibly damaging	Het
Tbpl2	A	T	2: 24,094,732	F133L	probably benign	Het
Tcrg-C3	C	A	13: 19,260,994	F37L	probably damaging	Het
Tnfrsf22	T	C	7: 143,638,389		probably benign	Het
Top2b	A	G	14: 16,398,916	E512G	probably damaging	Het
Ttc17	T	A	2: 94,364,345	H561L	probably benign	Het
Ttll4	G	T	1: 74,685,368	V566L	possibly damaging	Het
Ubqlnl	A	G	7: 104,148,485	Y602H	probably benign	Het
Vmn1r231	T	A	17: 20,889,950	E234D	probably damaging	Het
Wbp11	A	G	6: 136,820,585	S279P	probably damaging	Het
Wdr6	A	G	9: 108,576,534	L50P	probably damaging	Het
Zfp715	A	C	7: 43,298,649	I629S	possibly damaging	Het

Other mutations in Akap6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Akap6	APN	12	53140980	missense	possibly damaging	0.79
IGL00505:Akap6	APN	12	52887102	missense	possibly damaging	0.92
IGL01134:Akap6	APN	12	52937217	missense	probably damaging	0.96
IGL01458:Akap6	APN	12	52886818	nonsense	probably null
IGL01589:Akap6	APN	12	53139664	missense	probably damaging	1.00
IGL01592:Akap6	APN	12	53142142	missense	probably damaging	1.00
IGL01738:Akap6	APN	12	52886817	missense	probably damaging	0.99
IGL01867:Akap6	APN	12	52888008	missense	probably damaging	1.00
IGL02025:Akap6	APN	12	53140335	missense	probably benign
IGL02041:Akap6	APN	12	53140653	missense	probably damaging	1.00
IGL02058:Akap6	APN	12	53140555	missense	probably damaging	1.00
IGL02194:Akap6	APN	12	52886823	missense	probably benign	0.00
IGL02226:Akap6	APN	12	53010467	splice site	probably benign
IGL02323:Akap6	APN	12	53140429	missense	probably benign	0.00
IGL02449:Akap6	APN	12	53140188	missense	probably damaging	1.00
IGL02475:Akap6	APN	12	53139494	missense	probably benign	0.03
IGL02546:Akap6	APN	12	52880738	missense	probably damaging	1.00
IGL02547:Akap6	APN	12	53140696	missense	probably damaging	1.00
IGL02588:Akap6	APN	12	52886499	nonsense	probably null
IGL02608:Akap6	APN	12	53010606	missense	probably benign	0.39
IGL02884:Akap6	APN	12	52886622	missense	probably benign	0.00
IGL02945:Akap6	APN	12	52880837	missense	probably damaging	1.00
IGL03029:Akap6	APN	12	52886412	missense	probably damaging	1.00
IGL03129:Akap6	APN	12	53140306	missense	probably damaging	1.00
R0133:Akap6	UTSW	12	53139471	nonsense	probably null
R0166:Akap6	UTSW	12	53140924	missense	probably benign	0.04
R0189:Akap6	UTSW	12	53141254	missense	probably benign	0.41
R0532:Akap6	UTSW	12	52887983	missense	probably benign	0.00
R0632:Akap6	UTSW	12	52937148	missense	probably damaging	1.00
R0666:Akap6	UTSW	12	52911808	missense	probably damaging	1.00
R0723:Akap6	UTSW	12	53141902	missense	probably damaging	1.00
R0763:Akap6	UTSW	12	53142214	missense	possibly damaging	0.93
R0785:Akap6	UTSW	12	52886622	missense	probably benign	0.00
R0879:Akap6	UTSW	12	52880799	missense	probably damaging	1.00
R0880:Akap6	UTSW	12	53139508	missense	possibly damaging	0.93
R1033:Akap6	UTSW	12	53069222	missense	probably damaging	0.97
R1055:Akap6	UTSW	12	52880672	nonsense	probably null
R1199:Akap6	UTSW	12	52796190	missense	probably damaging	1.00
R1295:Akap6	UTSW	12	52887029	missense	probably damaging	1.00
R1389:Akap6	UTSW	12	53139520	missense	probably benign	0.15
R1471:Akap6	UTSW	12	53141496	missense	probably benign	0.05
R1483:Akap6	UTSW	12	52796087	missense	probably damaging	1.00
R1512:Akap6	UTSW	12	52937154	missense	probably damaging	1.00
R1648:Akap6	UTSW	12	53142006	nonsense	probably null
R1791:Akap6	UTSW	12	53069125	missense	probably damaging	1.00
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1891:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1899:Akap6	UTSW	12	53141852	missense	possibly damaging	0.95
R1917:Akap6	UTSW	12	53104612	missense	probably benign	0.13
R1970:Akap6	UTSW	12	52938475	missense	probably damaging	0.96
R1988:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R2153:Akap6	UTSW	12	53141404	missense	probably benign	0.03
R2567:Akap6	UTSW	12	52938373	missense	probably damaging	1.00
R2568:Akap6	UTSW	12	52887278	missense	possibly damaging	0.77
R3025:Akap6	UTSW	12	53140143	missense	probably benign
R3051:Akap6	UTSW	12	52887033	missense	probably damaging	1.00
R3195:Akap6	UTSW	12	53072457	nonsense	probably null
R3196:Akap6	UTSW	12	53072457	nonsense	probably null
R3426:Akap6	UTSW	12	52888034	missense	probably damaging	1.00
R3783:Akap6	UTSW	12	52880769	missense	probably damaging	1.00
R3934:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3936:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3967:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R3970:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R4042:Akap6	UTSW	12	53139379	critical splice acceptor site	probably null
R4095:Akap6	UTSW	12	53139462	missense	probably damaging	1.00
R4152:Akap6	UTSW	12	53140407	missense	probably benign	0.45
R4231:Akap6	UTSW	12	53141038	missense	probably damaging	1.00
R4232:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4233:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4234:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4235:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4236:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4475:Akap6	UTSW	12	53141643	missense	probably benign	0.00
R4513:Akap6	UTSW	12	52796004	missense	probably benign	0.03
R4686:Akap6	UTSW	12	52887623	frame shift	probably null
R4724:Akap6	UTSW	12	52795885	missense	possibly damaging	0.80
R4782:Akap6	UTSW	12	52887623	frame shift	probably null
R4852:Akap6	UTSW	12	53104675	missense	probably damaging	1.00
R5024:Akap6	UTSW	12	53142562	missense	probably benign	0.01
R5116:Akap6	UTSW	12	53141515	missense	probably benign	0.01
R5164:Akap6	UTSW	12	53142466	missense	probably benign
R5225:Akap6	UTSW	12	52886546	missense	probably damaging	1.00
R5269:Akap6	UTSW	12	53139843	missense	probably damaging	0.99
R5352:Akap6	UTSW	12	52796097	missense	probably damaging	1.00
R5496:Akap6	UTSW	12	53140653	missense	possibly damaging	0.87
R5551:Akap6	UTSW	12	52795964	missense	probably damaging	1.00
R5997:Akap6	UTSW	12	52937233	critical splice donor site	probably null
R6137:Akap6	UTSW	12	53140354	missense	probably damaging	1.00
R6151:Akap6	UTSW	12	53025792	missense	probably damaging	1.00
R6169:Akap6	UTSW	12	53142358	missense	probably benign
R6307:Akap6	UTSW	12	53141568	missense	possibly damaging	0.85
R6351:Akap6	UTSW	12	53142025	missense	probably damaging	0.98
R6479:Akap6	UTSW	12	53141169	missense	probably damaging	1.00
R6502:Akap6	UTSW	12	53140215	missense	probably damaging	1.00
R6760:Akap6	UTSW	12	53139778	missense	probably damaging	1.00
R6778:Akap6	UTSW	12	53025816	missense	probably damaging	1.00
R6837:Akap6	UTSW	12	53141262	missense	probably damaging	1.00
R6896:Akap6	UTSW	12	52887494	missense	probably benign	0.06
R6917:Akap6	UTSW	12	53069168	missense	probably null	0.97
R6983:Akap6	UTSW	12	52887653	missense	probably damaging	1.00
R7142:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7143:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7216:Akap6	UTSW	12	53140457	missense	probably benign	0.02
R7297:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7356:Akap6	UTSW	12	52911864	missense	probably damaging	1.00
R7378:Akap6	UTSW	12	53142574	missense	probably benign	0.00
R7382:Akap6	UTSW	12	53142171	missense	probably benign	0.00
R7498:Akap6	UTSW	12	53142705	nonsense	probably null
R7542:Akap6	UTSW	12	53069234	missense	probably damaging	1.00
R7589:Akap6	UTSW	12	53142063	nonsense	probably null
R7676:Akap6	UTSW	12	52886850	missense	possibly damaging	0.94
R7814:Akap6	UTSW	12	53140961	missense	probably benign	0.28
R7971:Akap6	UTSW	12	53139795	missense	probably damaging	1.00
R8039:Akap6	UTSW	12	53141676	missense	probably benign	0.00
R8425:Akap6	UTSW	12	52886621	missense	probably benign	0.00
R8747:Akap6	UTSW	12	53142216	missense	probably benign	0.01
R8885:Akap6	UTSW	12	53141536	missense	probably benign
R8956:Akap6	UTSW	12	53140344	missense	probably benign	0.00
R8989:Akap6	UTSW	12	52880871	missense	probably damaging	1.00
R9014:Akap6	UTSW	12	53139620	missense	possibly damaging	0.60
R9031:Akap6	UTSW	12	53142048	missense	probably benign	0.36
R9216:Akap6	UTSW	12	52880885	missense	probably benign	0.05
R9220:Akap6	UTSW	12	53140449	missense	possibly damaging	0.49
R9243:Akap6	UTSW	12	53141252	missense	probably benign	0.08
R9286:Akap6	UTSW	12	53072471	missense	possibly damaging	0.90
R9347:Akap6	UTSW	12	53069111	missense	probably damaging	1.00
R9475:Akap6	UTSW	12	53010552	missense	probably damaging	1.00
R9509:Akap6	UTSW	12	53142238	missense	probably damaging	0.99
R9523:Akap6	UTSW	12	52795889	missense	probably benign	0.02
X0062:Akap6	UTSW	12	53142361	missense	probably benign	0.43
Z1176:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TTGACATCCTATAAGAGCAACGAGG -3'
(R):5'- ATTGACGTCGCTCTCATCAGC -3'

Sequencing Primer
(F):5'- GCAACGAGGATCTTTTTAGCTGTCAC -3'
(R):5'- TCAGCCACCGAGCGATTCAG -3'

Posted On

2014-08-25