Mutagenetix > Incidental Mutation

Incidental Mutation 'R1987:Top2b'

222727

Institutional Source

Beutler Lab

Gene Symbol

Top2b

Ensembl Gene

ENSMUSG00000017485

Gene Name

topoisomerase (DNA) II beta

Synonyms

D230016L12Rik, Top-2

MMRRC Submission

039999-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.950) question?

Stock #

R1987 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16365179-16435462 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 16398916 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 512 (E512G)

Ref Sequence

ENSEMBL: ENSMUSP00000017629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017629]

AlphaFold

Q64511

Predicted Effect

probably damaging
Transcript: ENSMUST00000017629
AA Change: E512G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: E512G

Domain	Start	End	E-Value	Type
Blast:TOP2c	32	70	7e-10	BLAST
HATPase_c	85	234	1.91e-2	SMART
TOP2c	89	679	N/A	SMART
TOP4c	702	1175	2.55e-230	SMART
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1287	1299	N/A	INTRINSIC
low complexity region	1324	1336	N/A	INTRINSIC
low complexity region	1360	1382	N/A	INTRINSIC
Pfam:DTHCT	1495	1597	4.6e-31	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	T	11: 78,268,167	Q433L	probably damaging	Het
4932438A13Rik	T	A	3: 36,953,985		probably null	Het
Ahnak	A	T	19: 9,015,251	D4633V	probably damaging	Het
Akap6	T	C	12: 53,140,795	F1664S	possibly damaging	Het
Arhgef28	T	C	13: 97,967,096	M803V	probably benign	Het
BC117090	C	A	16: 36,321,832	G61C	probably damaging	Het
Ccdc73	T	A	2: 104,931,045	L130*	probably null	Het
Ccdc73	A	G	2: 104,999,159	E1059G	probably damaging	Het
Ccer2	A	C	7: 28,757,283	S151R	possibly damaging	Het
Cep128	T	A	12: 91,230,829	H406L	probably benign	Het
Cep135	A	G	5: 76,597,428	D229G	probably benign	Het
Cpvl	T	A	6: 53,954,611	D103V	probably benign	Het
Disp3	G	A	4: 148,258,753	A567V	probably damaging	Het
Dnah5	T	C	15: 28,343,591	I2379T	probably damaging	Het
Dnah6	T	C	6: 73,095,044	Y2433C	probably damaging	Het
Dock3	A	G	9: 107,108,421	I85T	probably benign	Het
Dock9	A	C	14: 121,591,830	S1380A	probably benign	Het
Erbin	T	C	13: 103,886,203	T43A	probably benign	Het
Fastkd3	T	C	13: 68,585,241	V502A	possibly damaging	Het
Fn1	T	C	1: 71,651,625	H59R	probably damaging	Het
Fsd2	A	G	7: 81,559,659	V145A	possibly damaging	Het
Fzr1	A	G	10: 81,370,319	V178A	probably damaging	Het
Gnpnat1	T	C	14: 45,380,998	R116G	probably damaging	Het
Grm7	T	A	6: 110,914,511	V235E	probably damaging	Het
Hdac4	A	C	1: 91,934,645	N1002K	probably damaging	Het
Hey1	C	T	3: 8,664,897	A167T	probably benign	Het
Hrnr	A	G	3: 93,332,604	N3383S	unknown	Het
Ints2	A	T	11: 86,217,800	V907D	probably benign	Het
Ispd	T	A	12: 36,521,996	L301Q	probably damaging	Het
Jchain	T	A	5: 88,521,467	Q109L	probably damaging	Het
Klhdc7a	A	T	4: 139,966,024	Y537*	probably null	Het
Klra1	C	T	6: 130,377,779	S92N	probably benign	Het
Krt31	C	T	11: 100,049,580	G150S	probably benign	Het
Lrrc71	G	A	3: 87,742,643	T326M	probably benign	Het
Lrrn4	T	C	2: 132,870,443	T487A	probably benign	Het
Map4k5	T	G	12: 69,842,912	R198S	probably damaging	Het
Men1	G	A	19: 6,338,837	C354Y	probably damaging	Het
Ms4a18	A	T	19: 11,013,655	V25E	probably damaging	Het
Mutyh	T	A	4: 116,819,368	S512R	possibly damaging	Het
Myh10	G	T	11: 68,814,496	A1947S	possibly damaging	Het
Nfasc	T	C	1: 132,610,886	D427G	probably damaging	Het
Nlrp9c	A	G	7: 26,378,056	M767T	probably benign	Het
Nrbp1	T	C	5: 31,245,391	L185P	probably damaging	Het
Pcdh9	G	A	14: 93,888,305	P143L	probably damaging	Het
Pcsk6	A	T	7: 65,927,287	M158L	possibly damaging	Het
Pkd1	G	T	17: 24,576,592		probably null	Het
Plk4	A	T	3: 40,805,817	S383C	possibly damaging	Het
Plxna2	T	C	1: 194,643,989	L77P	probably damaging	Het
Pnpla6	A	T	8: 3,542,370	T1209S	probably benign	Het
Prdm2	A	G	4: 143,132,509	S1404P	possibly damaging	Het
Preb	T	C	5: 30,958,813	D150G	probably damaging	Het
Prrt2	A	G	7: 127,018,730	V59A	probably benign	Het
Prss40	T	C	1: 34,558,014	N151S	possibly damaging	Het
Ptprt	G	T	2: 161,558,898	A1053D	probably damaging	Het
Ptprt	A	G	2: 161,766,321	V685A	possibly damaging	Het
Rfx4	C	T	10: 84,896,088	S549F	possibly damaging	Het
Rnaset2b	T	A	17: 6,996,477	V87E	probably benign	Het
Rnf213	G	A	11: 119,441,107	E2381K	probably damaging	Het
Sectm1a	A	T	11: 121,069,680	I103N	probably damaging	Het
Selp	T	A	1: 164,142,758	L597Q	probably damaging	Het
Sema6a	T	C	18: 47,300,142	D74G	probably damaging	Het
Serpinb9b	T	C	13: 33,029,559	V33A	probably benign	Het
Setd1b	A	T	5: 123,147,706	T272S	unknown	Het
Sgf29	G	C	7: 126,649,477		probably null	Het
Slc4a10	C	A	2: 62,268,204	Q561K	probably damaging	Het
Slc4a5	T	C	6: 83,273,232	I649T	possibly damaging	Het
Slc5a7	A	G	17: 54,293,835	Y91H	probably damaging	Het
Styxl1	T	C	5: 135,757,122	Y23C	probably damaging	Het
Tbc1d24	A	G	17: 24,206,872	V490A	possibly damaging	Het
Tbpl2	A	T	2: 24,094,732	F133L	probably benign	Het
Tcrg-C3	C	A	13: 19,260,994	F37L	probably damaging	Het
Tnfrsf22	T	C	7: 143,638,389		probably benign	Het
Ttc17	T	A	2: 94,364,345	H561L	probably benign	Het
Ttll4	G	T	1: 74,685,368	V566L	possibly damaging	Het
Ubqlnl	A	G	7: 104,148,485	Y602H	probably benign	Het
Vmn1r231	T	A	17: 20,889,950	E234D	probably damaging	Het
Wbp11	A	G	6: 136,820,585	S279P	probably damaging	Het
Wdr6	A	G	9: 108,576,534	L50P	probably damaging	Het
Zfp715	A	C	7: 43,298,649	I629S	possibly damaging	Het

Other mutations in Top2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Top2b	APN	14	16422692	missense	probably benign	0.00
IGL00730:Top2b	APN	14	16389831	missense	probably damaging	1.00
IGL00917:Top2b	APN	14	16407354	missense	probably benign	0.05
IGL01959:Top2b	APN	14	16422695	missense	probably benign	0.19
IGL02019:Top2b	APN	14	16409965	missense	probably benign	0.44
IGL02119:Top2b	APN	14	16406733	missense	probably damaging	1.00
IGL02136:Top2b	APN	14	16407103	unclassified	probably benign
IGL02148:Top2b	APN	14	16400488	missense	probably damaging	1.00
IGL02496:Top2b	APN	14	16387335	missense	probably benign
IGL02503:Top2b	APN	14	16407163	missense	possibly damaging	0.92
IGL02672:Top2b	APN	14	16409166	unclassified	probably benign
IGL02721:Top2b	APN	14	16409236	missense	probably damaging	1.00
IGL02886:Top2b	APN	14	16365688	missense	possibly damaging	0.73
IGL03252:Top2b	APN	14	16393163	missense	possibly damaging	0.60
PIT4434001:Top2b	UTSW	14	16423780	critical splice donor site	probably null
R0092:Top2b	UTSW	14	16409263	missense	probably damaging	1.00
R0201:Top2b	UTSW	14	16383174	missense	probably damaging	1.00
R0390:Top2b	UTSW	14	16418442	missense	probably benign	0.00
R0394:Top2b	UTSW	14	16413556	splice site	probably null
R1159:Top2b	UTSW	14	16430329	missense	possibly damaging	0.81
R1424:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R1519:Top2b	UTSW	14	16408953	splice site	probably null
R1561:Top2b	UTSW	14	16398993	missense	possibly damaging	0.80
R1713:Top2b	UTSW	14	16409823	missense	probably benign	0.05
R2219:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2287:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2422:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2679:Top2b	UTSW	14	16413947	missense	probably damaging	1.00
R3687:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3707:Top2b	UTSW	14	16388447	missense	probably damaging	1.00
R3810:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3812:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3815:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3816:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3818:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4023:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4025:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4026:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4133:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4157:Top2b	UTSW	14	16384491	missense	probably benign	0.42
R4179:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4180:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4300:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4376:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4377:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4492:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4549:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4550:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4581:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4582:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4628:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4630:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4667:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4668:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4669:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4698:Top2b	UTSW	14	16387331	nonsense	probably null
R4769:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R4809:Top2b	UTSW	14	16383125	missense	probably benign	0.06
R4899:Top2b	UTSW	14	16387313	missense	probably damaging	1.00
R5035:Top2b	UTSW	14	16409966	missense	probably benign	0.01
R5621:Top2b	UTSW	14	16387280	missense	probably damaging	1.00
R5631:Top2b	UTSW	14	16409882	missense	probably damaging	1.00
R5685:Top2b	UTSW	14	16413666	missense	probably damaging	1.00
R5732:Top2b	UTSW	14	16400106	missense	possibly damaging	0.92
R5939:Top2b	UTSW	14	16422786	missense	probably damaging	0.96
R6007:Top2b	UTSW	14	16423779	critical splice donor site	probably null
R6087:Top2b	UTSW	14	16409864	missense	probably benign	0.14
R6144:Top2b	UTSW	14	16423740	missense	possibly damaging	0.48
R6196:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6218:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6229:Top2b	UTSW	14	16409838	missense	probably damaging	1.00
R6249:Top2b	UTSW	14	16399006	missense	probably damaging	1.00
R6337:Top2b	UTSW	14	16399026	missense	possibly damaging	0.77
R6353:Top2b	UTSW	14	16416671	missense	probably damaging	1.00
R6512:Top2b	UTSW	14	16409854	missense	possibly damaging	0.94
R6573:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R6614:Top2b	UTSW	14	16407142	nonsense	probably null
R6844:Top2b	UTSW	14	16429383	missense	possibly damaging	0.94
R6848:Top2b	UTSW	14	16409958	missense	possibly damaging	0.89
R6871:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6895:Top2b	UTSW	14	16413604	missense	probably benign	0.06
R7162:Top2b	UTSW	14	16416653	missense	probably benign	0.00
R7247:Top2b	UTSW	14	16416962	missense	probably benign	0.08
R7250:Top2b	UTSW	14	16420411	missense	probably benign
R7359:Top2b	UTSW	14	16407376	missense	probably null	1.00
R7365:Top2b	UTSW	14	16416649	missense	probably benign	0.04
R7493:Top2b	UTSW	14	16416605	missense	probably benign	0.00
R7528:Top2b	UTSW	14	16395427	nonsense	probably null
R7562:Top2b	UTSW	14	16412946	missense	probably benign	0.04
R7594:Top2b	UTSW	14	16428587	missense	probably benign
R7670:Top2b	UTSW	14	16416620	missense	possibly damaging	0.61
R7894:Top2b	UTSW	14	16413081	missense	possibly damaging	0.68
R8031:Top2b	UTSW	14	16412986	missense	probably damaging	0.98
R8150:Top2b	UTSW	14	16393291	missense	probably damaging	0.99
R8214:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R8299:Top2b	UTSW	14	16386123	missense	possibly damaging	0.68
R8977:Top2b	UTSW	14	16393239	missense	probably benign	0.36
R9562:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9565:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9798:Top2b	UTSW	14	16389845	missense	probably damaging	1.00
X0028:Top2b	UTSW	14	16384499	nonsense	probably null
Z1176:Top2b	UTSW	14	16395434	missense	probably damaging	1.00
Z1177:Top2b	UTSW	14	16416953	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCTCAATGTACGAGAAGCCTC -3'
(R):5'- ACATCTGTCCTGCATCCAGC -3'

Sequencing Primer
(F):5'- GAGAAGCCTCTCATAAACAGGTTTG -3'
(R):5'- ATCCAGCATGCATTCATACATAC -3'

Posted On

2014-08-25