Incidental Mutation 'R1987:Top2b'
ID 222727
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Name topoisomerase (DNA) II beta
Synonyms Top-2, D230016L12Rik
MMRRC Submission 039999-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.924) question?
Stock # R1987 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 6038976-6104585 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16398916 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 512 (E512G)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629]
AlphaFold Q64511
Predicted Effect probably damaging
Transcript: ENSMUST00000017629
AA Change: E512G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: E512G

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 8,992,615 (GRCm39) D4633V probably damaging Het
Akap6 T C 12: 53,187,578 (GRCm39) F1664S possibly damaging Het
Arhgef28 T C 13: 98,103,604 (GRCm39) M803V probably benign Het
Bltp1 T A 3: 37,008,134 (GRCm39) probably null Het
Bltp2 A T 11: 78,158,993 (GRCm39) Q433L probably damaging Het
Ccdc73 T A 2: 104,761,390 (GRCm39) L130* probably null Het
Ccdc73 A G 2: 104,829,504 (GRCm39) E1059G probably damaging Het
Ccer2 A C 7: 28,456,708 (GRCm39) S151R possibly damaging Het
Cep128 T A 12: 91,197,603 (GRCm39) H406L probably benign Het
Cep135 A G 5: 76,745,275 (GRCm39) D229G probably benign Het
Cpvl T A 6: 53,931,596 (GRCm39) D103V probably benign Het
Crppa T A 12: 36,571,995 (GRCm39) L301Q probably damaging Het
Cstdc6 C A 16: 36,142,194 (GRCm39) G61C probably damaging Het
Disp3 G A 4: 148,343,210 (GRCm39) A567V probably damaging Het
Dnah5 T C 15: 28,343,737 (GRCm39) I2379T probably damaging Het
Dnah6 T C 6: 73,072,027 (GRCm39) Y2433C probably damaging Het
Dock3 A G 9: 106,985,620 (GRCm39) I85T probably benign Het
Dock9 A C 14: 121,829,242 (GRCm39) S1380A probably benign Het
Erbin T C 13: 104,022,711 (GRCm39) T43A probably benign Het
Fastkd3 T C 13: 68,733,360 (GRCm39) V502A possibly damaging Het
Fn1 T C 1: 71,690,784 (GRCm39) H59R probably damaging Het
Fsd2 A G 7: 81,209,407 (GRCm39) V145A possibly damaging Het
Fzr1 A G 10: 81,206,153 (GRCm39) V178A probably damaging Het
Gnpnat1 T C 14: 45,618,455 (GRCm39) R116G probably damaging Het
Grm7 T A 6: 110,891,472 (GRCm39) V235E probably damaging Het
Hdac4 A C 1: 91,862,367 (GRCm39) N1002K probably damaging Het
Hey1 C T 3: 8,729,957 (GRCm39) A167T probably benign Het
Hrnr A G 3: 93,239,911 (GRCm39) N3383S unknown Het
Ints2 A T 11: 86,108,626 (GRCm39) V907D probably benign Het
Jchain T A 5: 88,669,326 (GRCm39) Q109L probably damaging Het
Klhdc7a A T 4: 139,693,335 (GRCm39) Y537* probably null Het
Klra1 C T 6: 130,354,742 (GRCm39) S92N probably benign Het
Krt31 C T 11: 99,940,406 (GRCm39) G150S probably benign Het
Lrrc71 G A 3: 87,649,950 (GRCm39) T326M probably benign Het
Lrrn4 T C 2: 132,712,363 (GRCm39) T487A probably benign Het
Map4k5 T G 12: 69,889,686 (GRCm39) R198S probably damaging Het
Men1 G A 19: 6,388,867 (GRCm39) C354Y probably damaging Het
Ms4a18 A T 19: 10,991,019 (GRCm39) V25E probably damaging Het
Mutyh T A 4: 116,676,565 (GRCm39) S512R possibly damaging Het
Myh10 G T 11: 68,705,322 (GRCm39) A1947S possibly damaging Het
Nfasc T C 1: 132,538,624 (GRCm39) D427G probably damaging Het
Nlrp9c A G 7: 26,077,481 (GRCm39) M767T probably benign Het
Nrbp1 T C 5: 31,402,735 (GRCm39) L185P probably damaging Het
Pcdh9 G A 14: 94,125,741 (GRCm39) P143L probably damaging Het
Pcsk6 A T 7: 65,577,035 (GRCm39) M158L possibly damaging Het
Pkd1 G T 17: 24,795,566 (GRCm39) probably null Het
Plk4 A T 3: 40,760,252 (GRCm39) S383C possibly damaging Het
Plxna2 T C 1: 194,326,297 (GRCm39) L77P probably damaging Het
Pnpla6 A T 8: 3,592,370 (GRCm39) T1209S probably benign Het
Prdm2 A G 4: 142,859,079 (GRCm39) S1404P possibly damaging Het
Preb T C 5: 31,116,157 (GRCm39) D150G probably damaging Het
Prrt2 A G 7: 126,617,902 (GRCm39) V59A probably benign Het
Prss40 T C 1: 34,597,095 (GRCm39) N151S possibly damaging Het
Ptprt G T 2: 161,400,818 (GRCm39) A1053D probably damaging Het
Ptprt A G 2: 161,608,241 (GRCm39) V685A possibly damaging Het
Rfx4 C T 10: 84,731,952 (GRCm39) S549F possibly damaging Het
Rnaset2b T A 17: 7,263,876 (GRCm39) V87E probably benign Het
Rnf213 G A 11: 119,331,933 (GRCm39) E2381K probably damaging Het
Sectm1a A T 11: 120,960,506 (GRCm39) I103N probably damaging Het
Selp T A 1: 163,970,327 (GRCm39) L597Q probably damaging Het
Sema6a T C 18: 47,433,209 (GRCm39) D74G probably damaging Het
Serpinb9b T C 13: 33,213,542 (GRCm39) V33A probably benign Het
Setd1b A T 5: 123,285,769 (GRCm39) T272S unknown Het
Sgf29 G C 7: 126,248,649 (GRCm39) probably null Het
Slc4a10 C A 2: 62,098,548 (GRCm39) Q561K probably damaging Het
Slc4a5 T C 6: 83,250,214 (GRCm39) I649T possibly damaging Het
Slc5a7 A G 17: 54,600,863 (GRCm39) Y91H probably damaging Het
Styxl1 T C 5: 135,785,976 (GRCm39) Y23C probably damaging Het
Tbc1d24 A G 17: 24,425,846 (GRCm39) V490A possibly damaging Het
Tbpl2 A T 2: 23,984,744 (GRCm39) F133L probably benign Het
Tnfrsf22 T C 7: 143,192,126 (GRCm39) probably benign Het
Trgc3 C A 13: 19,445,164 (GRCm39) F37L probably damaging Het
Ttc17 T A 2: 94,194,690 (GRCm39) H561L probably benign Het
Ttll4 G T 1: 74,724,527 (GRCm39) V566L possibly damaging Het
Ubqlnl A G 7: 103,797,692 (GRCm39) Y602H probably benign Het
Vmn1r231 T A 17: 21,110,212 (GRCm39) E234D probably damaging Het
Wbp11 A G 6: 136,797,583 (GRCm39) S279P probably damaging Het
Wdr6 A G 9: 108,453,733 (GRCm39) L50P probably damaging Het
Zfp715 A C 7: 42,948,073 (GRCm39) I629S possibly damaging Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16,422,692 (GRCm38) missense probably benign 0.00
IGL00730:Top2b APN 14 16,389,831 (GRCm38) missense probably damaging 1.00
IGL00917:Top2b APN 14 16,407,354 (GRCm38) missense probably benign 0.05
IGL01959:Top2b APN 14 16,422,695 (GRCm38) missense probably benign 0.19
IGL02019:Top2b APN 14 16,409,965 (GRCm38) missense probably benign 0.44
IGL02119:Top2b APN 14 16,406,733 (GRCm38) missense probably damaging 1.00
IGL02136:Top2b APN 14 16,407,103 (GRCm38) unclassified probably benign
IGL02148:Top2b APN 14 16,400,488 (GRCm38) missense probably damaging 1.00
IGL02496:Top2b APN 14 16,387,335 (GRCm38) missense probably benign
IGL02503:Top2b APN 14 16,407,163 (GRCm38) missense possibly damaging 0.92
IGL02672:Top2b APN 14 16,409,166 (GRCm38) unclassified probably benign
IGL02721:Top2b APN 14 16,409,236 (GRCm38) missense probably damaging 1.00
IGL02886:Top2b APN 14 16,365,688 (GRCm38) missense possibly damaging 0.73
IGL03252:Top2b APN 14 16,393,163 (GRCm38) missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16,423,780 (GRCm38) critical splice donor site probably null
R0092:Top2b UTSW 14 16,409,263 (GRCm38) missense probably damaging 1.00
R0201:Top2b UTSW 14 16,383,174 (GRCm38) missense probably damaging 1.00
R0390:Top2b UTSW 14 16,418,442 (GRCm38) missense probably benign 0.00
R0394:Top2b UTSW 14 16,413,556 (GRCm38) splice site probably null
R1159:Top2b UTSW 14 16,430,329 (GRCm38) missense possibly damaging 0.81
R1424:Top2b UTSW 14 16,383,177 (GRCm38) missense probably damaging 1.00
R1519:Top2b UTSW 14 16,408,953 (GRCm38) splice site probably null
R1561:Top2b UTSW 14 16,398,993 (GRCm38) missense possibly damaging 0.80
R1713:Top2b UTSW 14 16,409,823 (GRCm38) missense probably benign 0.05
R2219:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2287:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2422:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2679:Top2b UTSW 14 16,413,947 (GRCm38) missense probably damaging 1.00
R3687:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3707:Top2b UTSW 14 16,388,447 (GRCm38) missense probably damaging 1.00
R3810:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3812:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3815:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3816:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3818:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4023:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4025:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4026:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4133:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4157:Top2b UTSW 14 16,384,491 (GRCm38) missense probably benign 0.42
R4179:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4180:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4300:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4376:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4377:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4492:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4549:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4550:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4581:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4582:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4628:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4630:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4667:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4668:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4669:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4698:Top2b UTSW 14 16,387,331 (GRCm38) nonsense probably null
R4769:Top2b UTSW 14 16,398,991 (GRCm38) missense probably damaging 1.00
R4809:Top2b UTSW 14 16,383,125 (GRCm38) missense probably benign 0.06
R4899:Top2b UTSW 14 16,387,313 (GRCm38) missense probably damaging 1.00
R5035:Top2b UTSW 14 16,409,966 (GRCm38) missense probably benign 0.01
R5621:Top2b UTSW 14 16,387,280 (GRCm38) missense probably damaging 1.00
R5631:Top2b UTSW 14 16,409,882 (GRCm38) missense probably damaging 1.00
R5685:Top2b UTSW 14 16,413,666 (GRCm38) missense probably damaging 1.00
R5732:Top2b UTSW 14 16,400,106 (GRCm38) missense possibly damaging 0.92
R5939:Top2b UTSW 14 16,422,786 (GRCm38) missense probably damaging 0.96
R6007:Top2b UTSW 14 16,423,779 (GRCm38) critical splice donor site probably null
R6087:Top2b UTSW 14 16,409,864 (GRCm38) missense probably benign 0.14
R6144:Top2b UTSW 14 16,423,740 (GRCm38) missense possibly damaging 0.48
R6196:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6218:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6229:Top2b UTSW 14 16,409,838 (GRCm38) missense probably damaging 1.00
R6249:Top2b UTSW 14 16,399,006 (GRCm38) missense probably damaging 1.00
R6337:Top2b UTSW 14 16,399,026 (GRCm38) missense possibly damaging 0.77
R6353:Top2b UTSW 14 16,416,671 (GRCm38) missense probably damaging 1.00
R6512:Top2b UTSW 14 16,409,854 (GRCm38) missense possibly damaging 0.94
R6573:Top2b UTSW 14 16,398,991 (GRCm38) missense probably damaging 1.00
R6614:Top2b UTSW 14 16,407,142 (GRCm38) nonsense probably null
R6844:Top2b UTSW 14 16,429,383 (GRCm38) missense possibly damaging 0.94
R6848:Top2b UTSW 14 16,409,958 (GRCm38) missense possibly damaging 0.89
R6871:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6895:Top2b UTSW 14 16,413,604 (GRCm38) missense probably benign 0.06
R7162:Top2b UTSW 14 16,416,653 (GRCm38) missense probably benign 0.00
R7247:Top2b UTSW 14 16,416,962 (GRCm38) missense probably benign 0.08
R7250:Top2b UTSW 14 16,420,411 (GRCm38) missense probably benign
R7359:Top2b UTSW 14 16,407,376 (GRCm38) missense probably null 1.00
R7365:Top2b UTSW 14 16,416,649 (GRCm38) missense probably benign 0.04
R7493:Top2b UTSW 14 16,416,605 (GRCm38) missense probably benign 0.00
R7528:Top2b UTSW 14 16,395,427 (GRCm38) nonsense probably null
R7562:Top2b UTSW 14 16,412,946 (GRCm38) missense probably benign 0.04
R7594:Top2b UTSW 14 16,428,587 (GRCm38) missense probably benign
R7670:Top2b UTSW 14 16,416,620 (GRCm38) missense possibly damaging 0.61
R7894:Top2b UTSW 14 16,413,081 (GRCm38) missense possibly damaging 0.68
R8031:Top2b UTSW 14 16,412,986 (GRCm38) missense probably damaging 0.98
R8150:Top2b UTSW 14 16,393,291 (GRCm38) missense probably damaging 0.99
R8214:Top2b UTSW 14 16,383,177 (GRCm38) missense probably damaging 1.00
R8299:Top2b UTSW 14 16,386,123 (GRCm38) missense possibly damaging 0.68
R8977:Top2b UTSW 14 16,393,239 (GRCm38) missense probably benign 0.36
R9562:Top2b UTSW 14 16,365,718 (GRCm38) missense probably benign 0.09
R9565:Top2b UTSW 14 16,365,718 (GRCm38) missense probably benign 0.09
R9798:Top2b UTSW 14 16,389,845 (GRCm38) missense probably damaging 1.00
X0028:Top2b UTSW 14 16,384,499 (GRCm38) nonsense probably null
Z1176:Top2b UTSW 14 16,395,434 (GRCm38) missense probably damaging 1.00
Z1177:Top2b UTSW 14 16,416,953 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTCAATGTACGAGAAGCCTC -3'
(R):5'- ACATCTGTCCTGCATCCAGC -3'

Sequencing Primer
(F):5'- GAGAAGCCTCTCATAAACAGGTTTG -3'
(R):5'- ATCCAGCATGCATTCATACATAC -3'
Posted On 2014-08-25