Incidental Mutation 'R2015:Slc2a8'
ID222728
Institutional Source Beutler Lab
Gene Symbol Slc2a8
Ensembl Gene ENSMUSG00000026791
Gene Namesolute carrier family 2, (facilitated glucose transporter), member 8
SynonymsD2Ertd44e, GlutX1, GLUT8
MMRRC Submission 040024-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R2015 (G1)
Quality Score102
Status Not validated
Chromosome2
Chromosomal Location32972990-32982083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 32981380 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 136 (V136G)
Ref Sequence ENSEMBL: ENSMUSP00000141959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028129] [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000137381] [ENSMUST00000153484] [ENSMUST00000193695] [ENSMUST00000194066] [ENSMUST00000195863]
Predicted Effect probably benign
Transcript: ENSMUST00000028129
AA Change: V136G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000028129
Gene: ENSMUSG00000026791
AA Change: V136G

DomainStartEndE-ValueType
Pfam:MFS_1 26 425 2e-22 PFAM
Pfam:Sugar_tr 29 474 2.7e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049618
SMART Domains Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860

DomainStartEndE-ValueType
Pfam:Rap_GAP 202 383 3.4e-73 PFAM
Pfam:CNH 475 780 3.5e-67 PFAM
low complexity region 793 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102810
SMART Domains Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860

DomainStartEndE-ValueType
Pfam:Rap_GAP 198 385 4.6e-67 PFAM
Pfam:CNH 471 776 1.8e-68 PFAM
low complexity region 789 800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130769
Predicted Effect probably benign
Transcript: ENSMUST00000137381
Predicted Effect probably benign
Transcript: ENSMUST00000153484
AA Change: V136G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000141959
Gene: ENSMUSG00000026791
AA Change: V136G

DomainStartEndE-ValueType
Pfam:MFS_1 26 296 1.4e-18 PFAM
Pfam:Sugar_tr 29 295 1.5e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191777
Predicted Effect probably benign
Transcript: ENSMUST00000193695
AA Change: V136G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000142100
Gene: ENSMUSG00000026791
AA Change: V136G

DomainStartEndE-ValueType
Pfam:MFS_1 26 290 1.2e-18 PFAM
Pfam:Sugar_tr 29 290 1.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194066
SMART Domains Protein: ENSMUSP00000141969
Gene: ENSMUSG00000026791

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195863
SMART Domains Protein: ENSMUSP00000141879
Gene: ENSMUSG00000026791

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 60 8.7e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the solute carrier 2A family, which includes intracellular glucose transporters. Based on sequence comparison, the glucose transporters are grouped into three classes and this gene is a member of class II. The encoded protein, like other members of the family, contains several conserved residues and motifs and 12 transmembrane domains with both amino and carboxyl ends being on the cytosolic side of the membrane. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for one null allele show reduced spermatozoan ATP levels, mitochondrial membrane potential and sperm motility, and a slight deviation from the expected Mendelian frequency. Homozygotes for another null allele show increased hippocampus cell proliferation and cardiac P-wave duration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C A 11: 101,987,218 H35Q probably damaging Het
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
Abca9 A T 11: 110,131,846 M1022K probably benign Het
Abhd4 T A 14: 54,262,832 H74Q probably damaging Het
Actg1 A G 11: 120,346,810 S49P possibly damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Aire T C 10: 78,042,958 D85G probably damaging Het
Akr1c18 T A 13: 4,145,309 D50V probably damaging Het
Ankrd13a C A 5: 114,792,109 A185E probably damaging Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Armc8 A T 9: 99,483,105 C661* probably null Het
Bbs10 C T 10: 111,300,855 Q610* probably null Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Bpifb9a T C 2: 154,268,200 probably null Het
Cdk14 T C 5: 5,380,082 K15R probably benign Het
Cdr1 A G X: 61,184,814 F249L probably benign Het
Cep250 A C 2: 155,981,453 H1009P probably damaging Het
Clasp2 A G 9: 113,911,500 T495A possibly damaging Het
Col19a1 C G 1: 24,559,753 G53A unknown Het
Cpne1 G A 2: 156,078,388 R166C probably damaging Het
Dtx3l G A 16: 35,936,427 H129Y probably benign Het
Ercc3 A G 18: 32,248,429 T433A probably benign Het
Gm9936 T A 5: 114,857,421 probably benign Het
Grina T C 15: 76,248,534 V167A probably damaging Het
Hcfc2 A G 10: 82,738,980 N618D probably benign Het
Herpud1 T C 8: 94,392,206 V196A probably benign Het
Hist3h2a T A 11: 58,954,928 L64Q probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Igll1 A G 16: 16,863,775 S39P probably benign Het
Kdm5a T C 6: 120,431,990 S1545P probably benign Het
Klra8 C A 6: 130,115,573 C255F probably damaging Het
Krtap4-6 A T 11: 99,665,572 C110S unknown Het
Lef1 T A 3: 131,111,587 I39N probably damaging Het
Lnpep G A 17: 17,579,063 T110I probably damaging Het
Lrp1 T A 10: 127,540,694 T4282S probably benign Het
Lrp6 A G 6: 134,480,374 probably null Het
Ly6g5b A C 17: 35,114,678 S53A possibly damaging Het
M6pr T G 6: 122,313,373 N98K probably damaging Het
Mal2 T C 15: 54,600,740 *176Q probably null Het
Mansc1 T C 6: 134,610,311 D301G possibly damaging Het
March1 C A 8: 66,121,821 N11K probably damaging Het
Mast3 T A 8: 70,787,363 I338F probably benign Het
Mcm3 A G 1: 20,803,580 L772P probably damaging Het
Mib2 C T 4: 155,657,880 G176D probably damaging Het
Mier2 A T 10: 79,541,202 probably null Het
Mogs C T 6: 83,117,650 R483* probably null Het
Msl2 G T 9: 101,075,251 probably benign Het
Naa16 A T 14: 79,345,059 M530K probably damaging Het
Nde1 A T 16: 14,169,457 probably benign Het
Ndufb10 T C 17: 24,722,529 probably null Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Npffr2 T A 5: 89,582,892 I227N probably damaging Het
Nup210l T A 3: 90,185,432 L1231Q probably damaging Het
Olfr1355 T C 10: 78,879,388 I72T possibly damaging Het
Olfr453 A G 6: 42,744,850 E271G probably damaging Het
Pclo C A 5: 14,521,501 P300Q probably damaging Het
Pik3c2a T A 7: 116,350,931 probably null Het
Plekha5 T A 6: 140,534,564 probably null Het
Pls1 A G 9: 95,761,365 V527A possibly damaging Het
Ppfia2 T C 10: 106,474,677 M15T probably benign Het
Prkd2 T A 7: 16,847,677 C152* probably null Het
Ptprq T G 10: 107,667,422 K792Q probably damaging Het
Rbbp8 T C 18: 11,720,624 M296T probably benign Het
Rfc3 T C 5: 151,647,538 probably null Het
Rnf17 A G 14: 56,486,969 N1090S probably benign Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Sdsl G A 5: 120,463,153 T18M probably damaging Het
Sepsecs T A 5: 52,647,624 Q365L probably benign Het
Sgta A T 10: 81,051,296 V45E probably damaging Het
Slc25a46 A T 18: 31,609,725 H29Q probably benign Het
Smg7 A T 1: 152,860,508 N166K probably damaging Het
Spata21 C T 4: 141,107,329 Q505* probably null Het
Strn4 T C 7: 16,833,028 S458P possibly damaging Het
Tbc1d22a C T 15: 86,299,684 T248M probably damaging Het
Trabd T A 15: 89,084,726 M149K possibly damaging Het
Trpv3 A T 11: 73,279,827 N178Y probably damaging Het
Try5 C T 6: 41,314,651 probably null Het
Tsg101 C T 7: 46,908,904 probably null Het
Ube3b A G 5: 114,411,149 E738G probably damaging Het
Unc13d A G 11: 116,068,755 S631P probably damaging Het
Unc5d T C 8: 28,758,979 T297A probably damaging Het
Usp18 A T 6: 121,268,550 E1V probably damaging Het
Vapb C A 2: 173,771,598 P97T probably benign Het
Vmn1r33 T A 6: 66,612,372 D66V probably benign Het
Vmn2r19 T A 6: 123,315,995 M332K probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vwde C A 6: 13,208,338 G182C possibly damaging Het
Wdfy3 A C 5: 101,860,486 S2778A probably null Het
Zbtb2 T A 10: 4,369,757 I90F possibly damaging Het
Zfp518b C A 5: 38,672,002 V887F probably benign Het
Zfp790 A G 7: 29,828,861 T324A probably benign Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Slc2a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slc2a8 APN 2 32973624 missense probably damaging 0.99
IGL01341:Slc2a8 APN 2 32975991 missense probably damaging 1.00
R0063:Slc2a8 UTSW 2 32979999 splice site probably null
R0063:Slc2a8 UTSW 2 32979999 splice site probably null
R0243:Slc2a8 UTSW 2 32980104 intron probably benign
R0530:Slc2a8 UTSW 2 32973684 missense probably benign 0.32
R0972:Slc2a8 UTSW 2 32975367 missense probably benign
R1919:Slc2a8 UTSW 2 32980079 missense probably damaging 1.00
R2893:Slc2a8 UTSW 2 32974954 missense probably damaging 1.00
R5144:Slc2a8 UTSW 2 32981773 missense probably damaging 0.96
R5685:Slc2a8 UTSW 2 32981789 missense possibly damaging 0.87
R5744:Slc2a8 UTSW 2 32976028 missense probably benign 0.00
R6717:Slc2a8 UTSW 2 32976177 missense probably damaging 1.00
R7828:Slc2a8 UTSW 2 32980068 nonsense probably null
R7834:Slc2a8 UTSW 2 32976907 missense probably damaging 1.00
R7917:Slc2a8 UTSW 2 32976907 missense probably damaging 1.00
X0061:Slc2a8 UTSW 2 32975448 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCCCAGTTAACAAGAAAATAGGG -3'
(R):5'- CTCTTTCCTCTGAGACTAGGGG -3'

Sequencing Primer
(F):5'- GGGCATTCCCGTTATCGCTG -3'
(R):5'- AAGGATCGTGGGCCATGGC -3'
Posted On2014-08-25