Incidental Mutation 'R0140:Pxdn'
ID22273
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Nameperoxidasin
SynonymsVPO1, 2310075M15Rik
MMRRC Submission 038425-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.704) question?
Stock #R0140 (G1)
Quality Score225
Status Validated (trace)
Chromosome12
Chromosomal Location29937608-30017658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29982754 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 179 (E179G)
Ref Sequence ENSEMBL: ENSMUSP00000113703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118321] [ENSMUST00000122328] [ENSMUST00000220271]
Predicted Effect probably benign
Transcript: ENSMUST00000118321
AA Change: E155G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113477
Gene: ENSMUSG00000020674
AA Change: E155G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122328
AA Change: E179G

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: E179G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155318
Predicted Effect probably benign
Transcript: ENSMUST00000220271
Meta Mutation Damage Score 0.0951 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
9330161L09Rik T C 12: 103,407,328 probably benign Het
Abca2 T G 2: 25,438,085 probably null Het
Adgrf3 T C 5: 30,196,381 K13R probably benign Het
Arhgap15 C A 2: 44,322,767 F416L probably damaging Het
Arhgef26 C G 3: 62,448,245 T746R probably benign Het
Aspm C T 1: 139,480,641 T2422I probably benign Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
AY358078 T A 14: 51,825,942 D348E probably benign Het
Blnk A T 19: 40,940,224 S285T probably damaging Het
Calr3 C T 8: 72,434,888 probably benign Het
Camsap2 A T 1: 136,280,382 V1124D probably benign Het
Ccdc40 G A 11: 119,264,299 G1122S probably benign Het
Ccdc69 C A 11: 55,050,499 C196F possibly damaging Het
Cdhr3 T G 12: 33,080,413 N141T probably benign Het
Cdk4 T C 10: 127,064,345 V37A probably damaging Het
Celsr2 C T 3: 108,397,933 R2110K probably benign Het
Clcn7 A G 17: 25,153,754 Y437C probably damaging Het
Col6a6 A G 9: 105,702,275 F1917S probably damaging Het
Cps1 T G 1: 67,180,116 S872A probably benign Het
Crebbp G T 16: 4,117,499 T842N probably damaging Het
Dennd2d G A 3: 106,492,483 V234I probably benign Het
Fam227b T C 2: 126,124,603 M130V possibly damaging Het
Fbxw24 G T 9: 109,605,414 L373I possibly damaging Het
Fubp3 T C 2: 31,608,184 Y359H probably damaging Het
Gm19684 T C 17: 36,127,427 probably benign Het
Hrnr C T 3: 93,331,493 Q3013* probably null Het
Il12rb1 T C 8: 70,819,771 probably benign Het
Lepr A T 4: 101,768,067 D473V probably damaging Het
Myof A T 19: 37,951,556 Y820* probably null Het
Nfil3 G A 13: 52,967,645 Q408* probably null Het
Nolc1 G A 19: 46,081,378 probably benign Het
Npbwr1 A C 1: 5,916,621 Y225D probably damaging Het
Nrip3 T C 7: 109,761,815 probably benign Het
Ntrk1 A C 3: 87,778,568 L749R probably damaging Het
Olfr1115 A G 2: 87,252,625 I229M probably damaging Het
Olfr1261 T A 2: 89,994,119 V242D probably damaging Het
Olfr222 A G 11: 59,570,978 L254P probably damaging Het
Olfr628 A G 7: 103,732,142 D72G probably damaging Het
Olfr801 G T 10: 129,669,688 T277N probably damaging Het
Paox A T 7: 140,134,058 T244S probably damaging Het
Pcdhb9 T A 18: 37,402,961 D669E possibly damaging Het
Pggt1b A G 18: 46,258,083 probably null Het
Phkg1 T A 5: 129,864,608 I334F probably benign Het
Phtf1 A T 3: 103,987,560 R208W probably null Het
Pnliprp2 A T 19: 58,766,363 I280F probably benign Het
Pnmal1 A G 7: 16,960,222 M1V probably null Het
Prcp A G 7: 92,928,611 T328A probably damaging Het
Racgap1 A T 15: 99,623,651 N541K probably benign Het
Rnf103 T A 6: 71,509,331 F315L possibly damaging Het
Sept2 A G 1: 93,501,639 R237G probably damaging Het
Setd6 T A 8: 95,716,109 L58Q probably damaging Het
Sipa1l1 G A 12: 82,396,200 V755I probably damaging Het
Slc16a12 G T 19: 34,672,704 probably benign Het
Slk G A 19: 47,622,335 D815N probably damaging Het
Stx1a T C 5: 135,045,585 probably benign Het
Tbc1d15 T A 10: 115,220,219 I283F probably damaging Het
Tenm4 T C 7: 96,896,052 I2425T possibly damaging Het
Tle1 G A 4: 72,120,185 H702Y probably damaging Het
Tmc6 A G 11: 117,766,251 probably benign Het
Tmem268 G A 4: 63,577,859 R179H possibly damaging Het
Tmem9 A G 1: 136,034,162 K165R probably damaging Het
Trpm6 A G 19: 18,819,194 probably null Het
Tufm C T 7: 126,489,831 P88S probably damaging Het
Ubqln1 A G 13: 58,193,289 I216T probably damaging Het
Urad T G 5: 147,322,331 M1L probably benign Het
Utp6 A G 11: 79,956,725 probably benign Het
Vav2 C T 2: 27,273,676 probably benign Het
Vmn2r55 G T 7: 12,668,177 Q395K possibly damaging Het
Wwox T G 8: 114,706,287 V231G probably damaging Het
Zfp646 T A 7: 127,883,506 N1618K probably benign Het
Zzef1 G A 11: 72,899,551 M2110I possibly damaging Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 29987099 missense probably damaging 1.00
IGL01152:Pxdn APN 12 30001937 missense probably damaging 0.99
IGL01286:Pxdn APN 12 29982754 missense probably benign 0.04
IGL01323:Pxdn APN 12 29987137 missense probably benign 0.00
IGL01338:Pxdn APN 12 30002797 missense probably damaging 1.00
IGL01341:Pxdn APN 12 30002487 missense probably damaging 1.00
IGL01401:Pxdn APN 12 30001984 missense probably damaging 1.00
IGL01580:Pxdn APN 12 29984493 missense probably benign 0.18
IGL01650:Pxdn APN 12 30002401 missense probably benign 0.01
IGL01679:Pxdn APN 12 29999902 missense probably damaging 0.97
IGL01866:Pxdn APN 12 29984571 missense probably benign 0.02
IGL02354:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02361:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02427:Pxdn APN 12 29984532 missense probably damaging 1.00
IGL02955:Pxdn APN 12 30003157 missense probably damaging 1.00
IGL03079:Pxdn APN 12 30002998 missense probably damaging 0.97
IGL03111:Pxdn APN 12 29982756 missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30003114 nonsense probably null
PIT4280001:Pxdn UTSW 12 29995328 missense probably damaging 0.99
PIT4469001:Pxdn UTSW 12 30005829 missense probably benign 0.00
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0086:Pxdn UTSW 12 30002419 missense possibly damaging 0.95
R0201:Pxdn UTSW 12 30002431 missense possibly damaging 0.79
R0282:Pxdn UTSW 12 29984440 nonsense probably null
R0310:Pxdn UTSW 12 30015529 missense probably damaging 1.00
R0426:Pxdn UTSW 12 29987066 missense possibly damaging 0.89
R0468:Pxdn UTSW 12 29994486 missense probably damaging 0.99
R0825:Pxdn UTSW 12 29984996 splice site probably benign
R0885:Pxdn UTSW 12 30003402 missense probably benign 0.30
R1420:Pxdn UTSW 12 30002068 missense probably damaging 1.00
R1588:Pxdn UTSW 12 30002559 missense probably damaging 1.00
R2269:Pxdn UTSW 12 30005775 missense probably damaging 0.97
R2280:Pxdn UTSW 12 29984906 missense probably damaging 0.98
R2504:Pxdn UTSW 12 30003406 missense probably damaging 1.00
R2679:Pxdn UTSW 12 29975569 splice site probably benign
R3116:Pxdn UTSW 12 30002307 missense possibly damaging 0.89
R3607:Pxdn UTSW 12 29990918 missense probably benign 0.04
R4033:Pxdn UTSW 12 30003225 missense probably benign 0.19
R4576:Pxdn UTSW 12 30011923 missense probably benign
R4659:Pxdn UTSW 12 29994553 missense probably benign 0.01
R4681:Pxdn UTSW 12 30012326 missense probably benign 0.45
R4968:Pxdn UTSW 12 30000012 missense probably benign 0.25
R5032:Pxdn UTSW 12 30003141 missense probably benign 0.08
R5232:Pxdn UTSW 12 29990988 missense probably benign 0.08
R5366:Pxdn UTSW 12 30002900 missense probably damaging 1.00
R5504:Pxdn UTSW 12 30002801 missense probably damaging 1.00
R5586:Pxdn UTSW 12 30003142 missense probably damaging 0.99
R5739:Pxdn UTSW 12 29982334 missense probably benign 0.03
R5877:Pxdn UTSW 12 30003046 missense probably damaging 1.00
R6167:Pxdn UTSW 12 29974001 missense probably damaging 1.00
R6191:Pxdn UTSW 12 29982717 missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30003112 missense probably damaging 1.00
R6609:Pxdn UTSW 12 30002941 missense probably benign 0.00
R6628:Pxdn UTSW 12 29999918 missense probably damaging 1.00
R6865:Pxdn UTSW 12 30014583 splice site probably null
R6921:Pxdn UTSW 12 30015505 missense probably damaging 0.96
R6995:Pxdn UTSW 12 29995371 missense possibly damaging 0.95
R7211:Pxdn UTSW 12 29984904 missense possibly damaging 0.77
R7220:Pxdn UTSW 12 29994480 missense probably benign 0.02
R7347:Pxdn UTSW 12 30012261 missense probably benign 0.01
R7402:Pxdn UTSW 12 30002439 missense probably damaging 1.00
R7408:Pxdn UTSW 12 29990945 missense probably benign 0.29
R7413:Pxdn UTSW 12 30002928 missense probably benign 0.00
R7447:Pxdn UTSW 12 29984927 missense probably damaging 1.00
R7572:Pxdn UTSW 12 30006705 missense probably damaging 1.00
R7708:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R7815:Pxdn UTSW 12 30005825 missense probably damaging 0.96
R7972:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8097:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8098:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8205:Pxdn UTSW 12 30006567 missense probably damaging 1.00
R8262:Pxdn UTSW 12 29999196 nonsense probably null
R8335:Pxdn UTSW 12 30002097 missense probably damaging 0.99
R8356:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8437:Pxdn UTSW 12 30002044 missense probably damaging 1.00
R8456:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8709:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8772:Pxdn UTSW 12 30015464 missense probably damaging 1.00
R8903:Pxdn UTSW 12 29990993 missense probably benign
Z1177:Pxdn UTSW 12 29990852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGCTGCCTGAACAGTGAAC -3'
(R):5'- TCCTGGCATAGAGATGCCTCTGAAG -3'

Sequencing Primer
(F):5'- CGGTGTAAAATCCAACTCTTGGC -3'
(R):5'- ATGCCTCTGAAGGCTTCGC -3'
Posted On2013-04-16