Mutagenetix > Incidental Mutation

Incidental Mutation 'R2015:Nup210l'

222740

Institutional Source

Beutler Lab

Gene Symbol

Nup210l

Ensembl Gene

ENSMUSG00000027939

Gene Name

nucleoporin 210-like

Synonyms

4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps

MMRRC Submission

040024-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.383) question?

Stock #

R2015 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90104132-90212048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 90185432 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 1231 (L1231Q)

Ref Sequence

ENSEMBL: ENSMUSP00000143368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]

AlphaFold

Q9D2F7

Predicted Effect

probably damaging
Transcript: ENSMUST00000029548
AA Change: L1231Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: L1231Q

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
BID_2	457	536	2.05e1	SMART
Blast:S1	949	1023	2e-16	BLAST
BID_2	1077	1152	4.51e-11	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200410
AA Change: L1231Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: L1231Q

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
BID_2	457	536	6.9e-2	SMART
Blast:S1	938	1023	9e-17	BLAST
BID_2	1077	1152	1.5e-13	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	C	A	11: 101,987,218	H35Q	probably damaging	Het
1700015F17Rik	T	A	5: 5,455,964	I106L	probably benign	Het
Abca9	A	T	11: 110,131,846	M1022K	probably benign	Het
Abhd4	T	A	14: 54,262,832	H74Q	probably damaging	Het
Actg1	A	G	11: 120,346,810	S49P	possibly damaging	Het
Adcy8	C	T	15: 64,767,878	G678S	probably benign	Het
Aire	T	C	10: 78,042,958	D85G	probably damaging	Het
Akr1c18	T	A	13: 4,145,309	D50V	probably damaging	Het
Ankrd13a	C	A	5: 114,792,109	A185E	probably damaging	Het
Apc	A	G	18: 34,315,591	I1813V	probably damaging	Het
Armc8	A	T	9: 99,483,105	C661*	probably null	Het
Bbs10	C	T	10: 111,300,855	Q610*	probably null	Het
Blm	T	C	7: 80,502,399	E600G	probably damaging	Het
Bpifb9a	T	C	2: 154,268,200		probably null	Het
Cdk14	T	C	5: 5,380,082	K15R	probably benign	Het
Cdr1	A	G	X: 61,184,814	F249L	probably benign	Het
Cep250	A	C	2: 155,981,453	H1009P	probably damaging	Het
Clasp2	A	G	9: 113,911,500	T495A	possibly damaging	Het
Col19a1	C	G	1: 24,559,753	G53A	unknown	Het
Cpne1	G	A	2: 156,078,388	R166C	probably damaging	Het
Dtx3l	G	A	16: 35,936,427	H129Y	probably benign	Het
Ercc3	A	G	18: 32,248,429	T433A	probably benign	Het
Gm9936	T	A	5: 114,857,421		probably benign	Het
Grina	T	C	15: 76,248,534	V167A	probably damaging	Het
Hcfc2	A	G	10: 82,738,980	N618D	probably benign	Het
Herpud1	T	C	8: 94,392,206	V196A	probably benign	Het
Hist3h2a	T	A	11: 58,954,928	L64Q	probably damaging	Het
Hlcs	A	G	16: 94,262,740	V487A	probably benign	Het
Hspa9	A	T	18: 34,946,648	Y243N	probably damaging	Het
Igll1	A	G	16: 16,863,775	S39P	probably benign	Het
Kdm5a	T	C	6: 120,431,990	S1545P	probably benign	Het
Klra8	C	A	6: 130,115,573	C255F	probably damaging	Het
Krtap4-6	A	T	11: 99,665,572	C110S	unknown	Het
Lef1	T	A	3: 131,111,587	I39N	probably damaging	Het
Lnpep	G	A	17: 17,579,063	T110I	probably damaging	Het
Lrp1	T	A	10: 127,540,694	T4282S	probably benign	Het
Lrp6	A	G	6: 134,480,374		probably null	Het
Ly6g5b	A	C	17: 35,114,678	S53A	possibly damaging	Het
M6pr	T	G	6: 122,313,373	N98K	probably damaging	Het
Mal2	T	C	15: 54,600,740	*176Q	probably null	Het
Mansc1	T	C	6: 134,610,311	D301G	possibly damaging	Het
March1	C	A	8: 66,121,821	N11K	probably damaging	Het
Mast3	T	A	8: 70,787,363	I338F	probably benign	Het
Mcm3	A	G	1: 20,803,580	L772P	probably damaging	Het
Mib2	C	T	4: 155,657,880	G176D	probably damaging	Het
Mier2	A	T	10: 79,541,202		probably null	Het
Mogs	C	T	6: 83,117,650	R483*	probably null	Het
Msl2	G	T	9: 101,075,251		probably benign	Het
Naa16	A	T	14: 79,345,059	M530K	probably damaging	Het
Nde1	A	T	16: 14,169,457		probably benign	Het
Ndufb10	T	C	17: 24,722,529		probably null	Het
Nhsl1	A	T	10: 18,511,592	R205W	probably damaging	Het
Npffr2	T	A	5: 89,582,892	I227N	probably damaging	Het
Olfr1355	T	C	10: 78,879,388	I72T	possibly damaging	Het
Olfr453	A	G	6: 42,744,850	E271G	probably damaging	Het
Pclo	C	A	5: 14,521,501	P300Q	probably damaging	Het
Pik3c2a	T	A	7: 116,350,931		probably null	Het
Plekha5	T	A	6: 140,534,564		probably null	Het
Pls1	A	G	9: 95,761,365	V527A	possibly damaging	Het
Ppfia2	T	C	10: 106,474,677	M15T	probably benign	Het
Prkd2	T	A	7: 16,847,677	C152*	probably null	Het
Ptprq	T	G	10: 107,667,422	K792Q	probably damaging	Het
Rbbp8	T	C	18: 11,720,624	M296T	probably benign	Het
Rfc3	T	C	5: 151,647,538		probably null	Het
Rnf17	A	G	14: 56,486,969	N1090S	probably benign	Het
Sash1	A	T	10: 8,729,413	V1071D	probably benign	Het
Sdsl	G	A	5: 120,463,153	T18M	probably damaging	Het
Sepsecs	T	A	5: 52,647,624	Q365L	probably benign	Het
Sgta	A	T	10: 81,051,296	V45E	probably damaging	Het
Slc25a46	A	T	18: 31,609,725	H29Q	probably benign	Het
Slc2a8	A	C	2: 32,981,380	V136G	probably benign	Het
Smg7	A	T	1: 152,860,508	N166K	probably damaging	Het
Spata21	C	T	4: 141,107,329	Q505*	probably null	Het
Strn4	T	C	7: 16,833,028	S458P	possibly damaging	Het
Tbc1d22a	C	T	15: 86,299,684	T248M	probably damaging	Het
Trabd	T	A	15: 89,084,726	M149K	possibly damaging	Het
Trpv3	A	T	11: 73,279,827	N178Y	probably damaging	Het
Try5	C	T	6: 41,314,651		probably null	Het
Tsg101	C	T	7: 46,908,904		probably null	Het
Ube3b	A	G	5: 114,411,149	E738G	probably damaging	Het
Unc13d	A	G	11: 116,068,755	S631P	probably damaging	Het
Unc5d	T	C	8: 28,758,979	T297A	probably damaging	Het
Usp18	A	T	6: 121,268,550	E1V	probably damaging	Het
Vapb	C	A	2: 173,771,598	P97T	probably benign	Het
Vmn1r33	T	A	6: 66,612,372	D66V	probably benign	Het
Vmn2r19	T	A	6: 123,315,995	M332K	probably benign	Het
Vmn2r71	T	A	7: 85,620,637	M452K	probably benign	Het
Vps13b	T	C	15: 35,607,142	S1074P	probably damaging	Het
Vwde	C	A	6: 13,208,338	G182C	possibly damaging	Het
Wdfy3	A	C	5: 101,860,486	S2778A	probably null	Het
Zbtb2	T	A	10: 4,369,757	I90F	possibly damaging	Het
Zfp518b	C	A	5: 38,672,002	V887F	probably benign	Het
Zfp790	A	G	7: 29,828,861	T324A	probably benign	Het
Zufsp	A	G	10: 33,929,824	V437A	possibly damaging	Het

Other mutations in Nup210l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Nup210l	APN	3	90190849	splice site	probably benign
IGL00813:Nup210l	APN	3	90132418	missense	probably benign	0.00
IGL01375:Nup210l	APN	3	90159893	missense	probably damaging	0.96
IGL01731:Nup210l	APN	3	90154566	missense	probably damaging	1.00
IGL01786:Nup210l	APN	3	90122776	nonsense	probably null
IGL01958:Nup210l	APN	3	90203924	missense	possibly damaging	0.74
IGL02094:Nup210l	APN	3	90180213	critical splice donor site	probably null
IGL02120:Nup210l	APN	3	90136862	missense	probably damaging	1.00
IGL02313:Nup210l	APN	3	90122792	missense	probably damaging	1.00
IGL02336:Nup210l	APN	3	90181552	critical splice donor site	probably null
IGL02348:Nup210l	APN	3	90104164	utr 5 prime	probably benign
IGL02372:Nup210l	APN	3	90201971	missense	possibly damaging	0.80
IGL02557:Nup210l	APN	3	90124230	missense	probably damaging	1.00
IGL02559:Nup210l	APN	3	90159953	missense	probably benign	0.02
IGL02738:Nup210l	APN	3	90136850	missense	possibly damaging	0.80
IGL03231:Nup210l	APN	3	90189545	missense	probably damaging	1.00
IGL03257:Nup210l	APN	3	90180148	critical splice acceptor site	probably null
IGL03388:Nup210l	APN	3	90170044	missense	probably damaging	1.00
IGL03134:Nup210l	UTSW	3	90190887	missense	possibly damaging	0.85
R0003:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R0040:Nup210l	UTSW	3	90181905	missense	probably damaging	1.00
R0083:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0090:Nup210l	UTSW	3	90211779	missense	probably benign	0.00
R0108:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0142:Nup210l	UTSW	3	90172113	missense	probably damaging	1.00
R0306:Nup210l	UTSW	3	90207368	missense	probably benign	0.13
R0332:Nup210l	UTSW	3	90132309	splice site	probably benign
R0346:Nup210l	UTSW	3	90189438	missense	probably damaging	1.00
R0463:Nup210l	UTSW	3	90180211	missense	probably null	1.00
R0622:Nup210l	UTSW	3	90167740	missense	probably damaging	0.98
R0765:Nup210l	UTSW	3	90119877	missense	probably damaging	0.99
R0990:Nup210l	UTSW	3	90211925	missense	probably benign	0.00
R1014:Nup210l	UTSW	3	90170048	missense	possibly damaging	0.62
R1036:Nup210l	UTSW	3	90192940	splice site	probably benign
R1177:Nup210l	UTSW	3	90202003	missense	probably benign	0.11
R1183:Nup210l	UTSW	3	90159945	missense	probably benign	0.04
R1188:Nup210l	UTSW	3	90198179	missense	probably benign	0.16
R1457:Nup210l	UTSW	3	90190972	missense	possibly damaging	0.68
R1471:Nup210l	UTSW	3	90170562	missense	probably benign
R1627:Nup210l	UTSW	3	90144169	missense	probably benign	0.15
R1778:Nup210l	UTSW	3	90189486	missense	probably damaging	0.99
R1827:Nup210l	UTSW	3	90154557	missense	probably damaging	1.00
R1843:Nup210l	UTSW	3	90172086	missense	probably damaging	0.96
R1858:Nup210l	UTSW	3	90154499	missense	probably damaging	0.97
R1942:Nup210l	UTSW	3	90151237	missense	probably benign	0.01
R2113:Nup210l	UTSW	3	90190974	missense	possibly damaging	0.48
R2944:Nup210l	UTSW	3	90181545	missense	probably damaging	1.00
R3736:Nup210l	UTSW	3	90120013	missense	probably damaging	1.00
R3740:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3741:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3742:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3771:Nup210l	UTSW	3	90119894	nonsense	probably null
R3773:Nup210l	UTSW	3	90119894	nonsense	probably null
R3879:Nup210l	UTSW	3	90185473	missense	probably damaging	1.00
R3882:Nup210l	UTSW	3	90124210	missense	probably benign	0.19
R3953:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3954:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3955:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3956:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R4200:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R4290:Nup210l	UTSW	3	90207326	missense	probably benign	0.00
R4328:Nup210l	UTSW	3	90175835	splice site	probably null
R4629:Nup210l	UTSW	3	90167875	missense	probably benign	0.21
R4629:Nup210l	UTSW	3	90190874	nonsense	probably null
R4897:Nup210l	UTSW	3	90193071	missense	probably damaging	1.00
R4906:Nup210l	UTSW	3	90170030	missense	probably benign	0.06
R4966:Nup210l	UTSW	3	90106901	missense	probably benign	0.00
R5004:Nup210l	UTSW	3	90180165	nonsense	probably null
R5237:Nup210l	UTSW	3	90180198	missense	probably benign	0.00
R5499:Nup210l	UTSW	3	90174370	missense	probably damaging	1.00
R5522:Nup210l	UTSW	3	90154665	missense	probably benign	0.10
R5627:Nup210l	UTSW	3	90144250	missense	probably damaging	0.97
R5678:Nup210l	UTSW	3	90190959	missense	probably damaging	0.99
R5726:Nup210l	UTSW	3	90129207	splice site	probably null
R5792:Nup210l	UTSW	3	90199857	missense	probably damaging	1.00
R6129:Nup210l	UTSW	3	90104176	missense	probably benign	0.00
R6272:Nup210l	UTSW	3	90170024	missense	possibly damaging	0.57
R6290:Nup210l	UTSW	3	90119909	nonsense	probably null
R6293:Nup210l	UTSW	3	90115064	missense	probably damaging	1.00
R6446:Nup210l	UTSW	3	90172068	missense	probably damaging	1.00
R6698:Nup210l	UTSW	3	90182508	missense	possibly damaging	0.57
R6855:Nup210l	UTSW	3	90136924	missense	probably benign	0.01
R6895:Nup210l	UTSW	3	90159924	missense	probably damaging	0.97
R6899:Nup210l	UTSW	3	90167897	missense	possibly damaging	0.77
R6978:Nup210l	UTSW	3	90154566	missense	possibly damaging	0.86
R6980:Nup210l	UTSW	3	90119927	missense	probably benign	0.04
R7038:Nup210l	UTSW	3	90159947	missense	probably damaging	1.00
R7273:Nup210l	UTSW	3	90118547	missense	probably benign	0.04
R7450:Nup210l	UTSW	3	90115188	critical splice donor site	probably null
R7514:Nup210l	UTSW	3	90210459	critical splice donor site	probably null
R7658:Nup210l	UTSW	3	90211993	missense	probably benign	0.43
R7735:Nup210l	UTSW	3	90185576	missense	probably damaging	1.00
R7772:Nup210l	UTSW	3	90159926	missense	probably damaging	1.00
R7800:Nup210l	UTSW	3	90134597	missense	probably damaging	1.00
R7840:Nup210l	UTSW	3	90122729	missense	probably benign	0.08
R7847:Nup210l	UTSW	3	90151123	missense	probably benign
R7848:Nup210l	UTSW	3	90203905	missense	probably benign	0.01
R8084:Nup210l	UTSW	3	90136058	missense	probably benign	0.15
R8121:Nup210l	UTSW	3	90115121	missense	probably damaging	1.00
R8421:Nup210l	UTSW	3	90203867	missense	probably damaging	1.00
R8458:Nup210l	UTSW	3	90185567	missense	probably null	1.00
R8701:Nup210l	UTSW	3	90122814	missense	probably benign	0.41
R8720:Nup210l	UTSW	3	90210374	missense	probably benign	0.00
R8770:Nup210l	UTSW	3	90118543	missense	probably damaging	1.00
R8896:Nup210l	UTSW	3	90118625	missense	probably damaging	1.00
R9033:Nup210l	UTSW	3	90198089	missense	probably benign
R9371:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9373:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9381:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9426:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9427:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9501:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9523:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9574:Nup210l	UTSW	3	90210386	missense	probably benign
R9612:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9654:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9660:Nup210l	UTSW	3	90198095	missense	probably benign	0.30
R9660:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9662:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9682:Nup210l	UTSW	3	90144162	missense	possibly damaging	0.79
R9729:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9750:Nup210l	UTSW	3	90210352	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTGTATCTGGAAATGACCTTGGAC -3'
(R):5'- AACAGGATTTAGGTGGGTGC -3'

Sequencing Primer
(F):5'- TGACTGCCTCTGAGCAATAG -3'
(R):5'- AACAGGATTTAGGTGGGTGCTTACC -3'

Posted On

2014-08-25