Incidental Mutation 'R2015:Mib2'
ID222748
Institutional Source Beutler Lab
Gene Symbol Mib2
Ensembl Gene ENSMUSG00000029060
Gene Namemindbomb E3 ubiquitin protein ligase 2
Synonyms2210008I11Rik, Zzank1
MMRRC Submission 040024-MU
Accession Numbers

Ncbi RefSeq: NM_001256107.1, NM_145124.3, NM_001256108.2; MGI:2679684

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2015 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155654677-155669198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 155657880 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 176 (G176D)
Ref Sequence ENSEMBL: ENSMUSP00000122269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030937] [ENSMUST00000103176] [ENSMUST00000141108]
Predicted Effect probably benign
Transcript: ENSMUST00000030937
SMART Domains Protein: ENSMUSP00000030937
Gene: ENSMUSG00000029061

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
ZnMc 85 256 8.39e-48 SMART
ShKT 255 291 4.06e-10 SMART
IG 307 390 4.53e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103176
AA Change: G315D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099465
Gene: ENSMUSG00000029060
AA Change: G315D

DomainStartEndE-ValueType
Pfam:MIB_HERC2 12 78 3.4e-26 PFAM
ZnF_ZZ 85 130 6.44e-9 SMART
Pfam:MIB_HERC2 160 225 4.2e-26 PFAM
Blast:ANK 285 320 2e-13 BLAST
ANK 428 457 8.52e-4 SMART
ANK 461 490 6.71e-2 SMART
ANK 494 523 9.93e-5 SMART
ANK 527 559 1.1e2 SMART
ANK 563 593 9.21e0 SMART
ANK 597 627 3.57e-6 SMART
ANK 631 660 3.31e-1 SMART
ANK 664 709 1.73e3 SMART
Blast:ANK 733 762 9e-10 BLAST
low complexity region 763 772 N/A INTRINSIC
RING 798 832 2.55e-1 SMART
RING 877 909 1.81e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139788
Predicted Effect probably damaging
Transcript: ENSMUST00000141108
AA Change: G176D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122269
Gene: ENSMUSG00000029060
AA Change: G176D

DomainStartEndE-ValueType
Pfam:MIB_HERC2 1 52 7.1e-17 PFAM
internal_repeat_1 82 150 7.77e-12 PROSPERO
internal_repeat_1 153 220 7.77e-12 PROSPERO
ANK 289 318 8.52e-4 SMART
ANK 322 351 6.71e-2 SMART
Pfam:Ank 356 375 2.9e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155189
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype Strain: 3652500; 3804450
PHENOTYPE: Mice homozygous for a knock-out allele display exencephaly with a variable penetrance that depends on the genetic background. Mice homozygous for a reporter/null allele are viable, fertile and show normal growth, body weight and brain morphology. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(5) Gene trapped(11)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C A 11: 101,987,218 H35Q probably damaging Het
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
Abca9 A T 11: 110,131,846 M1022K probably benign Het
Abhd4 T A 14: 54,262,832 H74Q probably damaging Het
Actg1 A G 11: 120,346,810 S49P possibly damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Aire T C 10: 78,042,958 D85G probably damaging Het
Akr1c18 T A 13: 4,145,309 D50V probably damaging Het
Ankrd13a C A 5: 114,792,109 A185E probably damaging Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Armc8 A T 9: 99,483,105 C661* probably null Het
Bbs10 C T 10: 111,300,855 Q610* probably null Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Bpifb9a T C 2: 154,268,200 probably null Het
Cdk14 T C 5: 5,380,082 K15R probably benign Het
Cdr1 A G X: 61,184,814 F249L probably benign Het
Cep250 A C 2: 155,981,453 H1009P probably damaging Het
Clasp2 A G 9: 113,911,500 T495A possibly damaging Het
Col19a1 C G 1: 24,559,753 G53A unknown Het
Cpne1 G A 2: 156,078,388 R166C probably damaging Het
Dtx3l G A 16: 35,936,427 H129Y probably benign Het
Ercc3 A G 18: 32,248,429 T433A probably benign Het
Gm9936 T A 5: 114,857,421 probably benign Het
Grina T C 15: 76,248,534 V167A probably damaging Het
Hcfc2 A G 10: 82,738,980 N618D probably benign Het
Herpud1 T C 8: 94,392,206 V196A probably benign Het
Hist3h2a T A 11: 58,954,928 L64Q probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Igll1 A G 16: 16,863,775 S39P probably benign Het
Kdm5a T C 6: 120,431,990 S1545P probably benign Het
Klra8 C A 6: 130,115,573 C255F probably damaging Het
Krtap4-6 A T 11: 99,665,572 C110S unknown Het
Lef1 T A 3: 131,111,587 I39N probably damaging Het
Lnpep G A 17: 17,579,063 T110I probably damaging Het
Lrp1 T A 10: 127,540,694 T4282S probably benign Het
Lrp6 A G 6: 134,480,374 probably null Het
Ly6g5b A C 17: 35,114,678 S53A possibly damaging Het
M6pr T G 6: 122,313,373 N98K probably damaging Het
Mal2 T C 15: 54,600,740 *176Q probably null Het
Mansc1 T C 6: 134,610,311 D301G possibly damaging Het
March1 C A 8: 66,121,821 N11K probably damaging Het
Mast3 T A 8: 70,787,363 I338F probably benign Het
Mcm3 A G 1: 20,803,580 L772P probably damaging Het
Mier2 A T 10: 79,541,202 probably null Het
Mogs C T 6: 83,117,650 R483* probably null Het
Msl2 G T 9: 101,075,251 probably benign Het
Naa16 A T 14: 79,345,059 M530K probably damaging Het
Nde1 A T 16: 14,169,457 probably benign Het
Ndufb10 T C 17: 24,722,529 probably null Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Npffr2 T A 5: 89,582,892 I227N probably damaging Het
Nup210l T A 3: 90,185,432 L1231Q probably damaging Het
Olfr1355 T C 10: 78,879,388 I72T possibly damaging Het
Olfr453 A G 6: 42,744,850 E271G probably damaging Het
Pclo C A 5: 14,521,501 P300Q probably damaging Het
Pik3c2a T A 7: 116,350,931 probably null Het
Plekha5 T A 6: 140,534,564 probably null Het
Pls1 A G 9: 95,761,365 V527A possibly damaging Het
Ppfia2 T C 10: 106,474,677 M15T probably benign Het
Prkd2 T A 7: 16,847,677 C152* probably null Het
Ptprq T G 10: 107,667,422 K792Q probably damaging Het
Rbbp8 T C 18: 11,720,624 M296T probably benign Het
Rfc3 T C 5: 151,647,538 probably null Het
Rnf17 A G 14: 56,486,969 N1090S probably benign Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Sdsl G A 5: 120,463,153 T18M probably damaging Het
Sepsecs T A 5: 52,647,624 Q365L probably benign Het
Sgta A T 10: 81,051,296 V45E probably damaging Het
Slc25a46 A T 18: 31,609,725 H29Q probably benign Het
Slc2a8 A C 2: 32,981,380 V136G probably benign Het
Smg7 A T 1: 152,860,508 N166K probably damaging Het
Spata21 C T 4: 141,107,329 Q505* probably null Het
Strn4 T C 7: 16,833,028 S458P possibly damaging Het
Tbc1d22a C T 15: 86,299,684 T248M probably damaging Het
Trabd T A 15: 89,084,726 M149K possibly damaging Het
Trpv3 A T 11: 73,279,827 N178Y probably damaging Het
Try5 C T 6: 41,314,651 probably null Het
Tsg101 C T 7: 46,908,904 probably null Het
Ube3b A G 5: 114,411,149 E738G probably damaging Het
Unc13d A G 11: 116,068,755 S631P probably damaging Het
Unc5d T C 8: 28,758,979 T297A probably damaging Het
Usp18 A T 6: 121,268,550 E1V probably damaging Het
Vapb C A 2: 173,771,598 P97T probably benign Het
Vmn1r33 T A 6: 66,612,372 D66V probably benign Het
Vmn2r19 T A 6: 123,315,995 M332K probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vwde C A 6: 13,208,338 G182C possibly damaging Het
Wdfy3 A C 5: 101,860,486 S2778A probably null Het
Zbtb2 T A 10: 4,369,757 I90F possibly damaging Het
Zfp518b C A 5: 38,672,002 V887F probably benign Het
Zfp790 A G 7: 29,828,861 T324A probably benign Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Mib2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Mib2 APN 4 155657730 missense probably damaging 1.00
IGL01404:Mib2 APN 4 155654936 missense probably damaging 1.00
IGL01819:Mib2 APN 4 155655258 unclassified probably null
IGL02147:Mib2 APN 4 155657687 missense probably benign
IGL02260:Mib2 APN 4 155661171 missense probably damaging 1.00
IGL02472:Mib2 APN 4 155656746 missense probably damaging 1.00
IGL02632:Mib2 APN 4 155655579 missense probably damaging 0.98
IGL03051:Mib2 APN 4 155657290 missense probably damaging 1.00
IGL03077:Mib2 APN 4 155659443 missense probably benign 0.01
R0042:Mib2 UTSW 4 155659440 nonsense probably null
R0042:Mib2 UTSW 4 155659440 nonsense probably null
R0115:Mib2 UTSW 4 155656062 unclassified probably benign
R0193:Mib2 UTSW 4 155655673 missense probably benign
R0279:Mib2 UTSW 4 155661216 missense possibly damaging 0.89
R0373:Mib2 UTSW 4 155656288 missense probably damaging 1.00
R0481:Mib2 UTSW 4 155656062 unclassified probably benign
R0563:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0564:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0625:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0714:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0740:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0942:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0987:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1023:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1033:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1037:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1460:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1481:Mib2 UTSW 4 155656999 missense probably benign 0.01
R1712:Mib2 UTSW 4 155654799 missense probably damaging 1.00
R2072:Mib2 UTSW 4 155659701 missense probably damaging 0.99
R2131:Mib2 UTSW 4 155655238 unclassified probably null
R2187:Mib2 UTSW 4 155654933 missense possibly damaging 0.95
R3751:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R3752:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R3753:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R4381:Mib2 UTSW 4 155657612 missense possibly damaging 0.55
R4584:Mib2 UTSW 4 155657287 missense probably damaging 1.00
R4669:Mib2 UTSW 4 155657415 missense possibly damaging 0.49
R4754:Mib2 UTSW 4 155655365 missense possibly damaging 0.90
R4782:Mib2 UTSW 4 155659772 missense probably benign 0.00
R4799:Mib2 UTSW 4 155659772 missense probably benign 0.00
R5036:Mib2 UTSW 4 155656288 missense probably damaging 1.00
R5073:Mib2 UTSW 4 155656776 missense probably damaging 1.00
R5915:Mib2 UTSW 4 155656051 unclassified probably benign
R6695:Mib2 UTSW 4 155661172 missense probably damaging 1.00
R7039:Mib2 UTSW 4 155659701 missense probably damaging 0.99
R7234:Mib2 UTSW 4 155657893 missense probably damaging 1.00
R7582:Mib2 UTSW 4 155654810 missense probably benign
R8133:Mib2 UTSW 4 155657001 missense probably benign 0.00
X0012:Mib2 UTSW 4 155655395 unclassified probably null
Z1176:Mib2 UTSW 4 155661141 missense probably benign 0.06
Z1177:Mib2 UTSW 4 155655521 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACATCCAGGTTGGCGTCTTC -3'
(R):5'- GCCAAGGTTGTCTTCTTGC -3'

Sequencing Primer
(F):5'- CAGGTTGGCGTCTTCCTCAG -3'
(R):5'- CTTCTTGCCCTGTGGAGCAG -3'
Posted On2014-08-25