Incidental Mutation 'R1987:Ms4a18'
ID 222763
Institutional Source Beutler Lab
Gene Symbol Ms4a18
Ensembl Gene ENSMUSG00000094584
Gene Name membrane-spanning 4-domains, subfamily A, member 18
Synonyms 5033428B15Rik
MMRRC Submission 039999-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R1987 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 10974388-10995390 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 10991019 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 25 (V25E)
Ref Sequence ENSEMBL: ENSMUSP00000136529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177684]
AlphaFold J3QN01
Predicted Effect probably damaging
Transcript: ENSMUST00000177684
AA Change: V25E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136529
Gene: ENSMUSG00000094584
AA Change: V25E

DomainStartEndE-ValueType
Pfam:CD20 152 299 1.2e-18 PFAM
low complexity region 300 324 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A T 19: 8,992,615 (GRCm39) D4633V probably damaging Het
Akap6 T C 12: 53,187,578 (GRCm39) F1664S possibly damaging Het
Arhgef28 T C 13: 98,103,604 (GRCm39) M803V probably benign Het
Bltp1 T A 3: 37,008,134 (GRCm39) probably null Het
Bltp2 A T 11: 78,158,993 (GRCm39) Q433L probably damaging Het
Ccdc73 T A 2: 104,761,390 (GRCm39) L130* probably null Het
Ccdc73 A G 2: 104,829,504 (GRCm39) E1059G probably damaging Het
Ccer2 A C 7: 28,456,708 (GRCm39) S151R possibly damaging Het
Cep128 T A 12: 91,197,603 (GRCm39) H406L probably benign Het
Cep135 A G 5: 76,745,275 (GRCm39) D229G probably benign Het
Cpvl T A 6: 53,931,596 (GRCm39) D103V probably benign Het
Crppa T A 12: 36,571,995 (GRCm39) L301Q probably damaging Het
Cstdc6 C A 16: 36,142,194 (GRCm39) G61C probably damaging Het
Disp3 G A 4: 148,343,210 (GRCm39) A567V probably damaging Het
Dnah5 T C 15: 28,343,737 (GRCm39) I2379T probably damaging Het
Dnah6 T C 6: 73,072,027 (GRCm39) Y2433C probably damaging Het
Dock3 A G 9: 106,985,620 (GRCm39) I85T probably benign Het
Dock9 A C 14: 121,829,242 (GRCm39) S1380A probably benign Het
Erbin T C 13: 104,022,711 (GRCm39) T43A probably benign Het
Fastkd3 T C 13: 68,733,360 (GRCm39) V502A possibly damaging Het
Fn1 T C 1: 71,690,784 (GRCm39) H59R probably damaging Het
Fsd2 A G 7: 81,209,407 (GRCm39) V145A possibly damaging Het
Fzr1 A G 10: 81,206,153 (GRCm39) V178A probably damaging Het
Gnpnat1 T C 14: 45,618,455 (GRCm39) R116G probably damaging Het
Grm7 T A 6: 110,891,472 (GRCm39) V235E probably damaging Het
Hdac4 A C 1: 91,862,367 (GRCm39) N1002K probably damaging Het
Hey1 C T 3: 8,729,957 (GRCm39) A167T probably benign Het
Hrnr A G 3: 93,239,911 (GRCm39) N3383S unknown Het
Ints2 A T 11: 86,108,626 (GRCm39) V907D probably benign Het
Jchain T A 5: 88,669,326 (GRCm39) Q109L probably damaging Het
Klhdc7a A T 4: 139,693,335 (GRCm39) Y537* probably null Het
Klra1 C T 6: 130,354,742 (GRCm39) S92N probably benign Het
Krt31 C T 11: 99,940,406 (GRCm39) G150S probably benign Het
Lrrc71 G A 3: 87,649,950 (GRCm39) T326M probably benign Het
Lrrn4 T C 2: 132,712,363 (GRCm39) T487A probably benign Het
Map4k5 T G 12: 69,889,686 (GRCm39) R198S probably damaging Het
Men1 G A 19: 6,388,867 (GRCm39) C354Y probably damaging Het
Mutyh T A 4: 116,676,565 (GRCm39) S512R possibly damaging Het
Myh10 G T 11: 68,705,322 (GRCm39) A1947S possibly damaging Het
Nfasc T C 1: 132,538,624 (GRCm39) D427G probably damaging Het
Nlrp9c A G 7: 26,077,481 (GRCm39) M767T probably benign Het
Nrbp1 T C 5: 31,402,735 (GRCm39) L185P probably damaging Het
Pcdh9 G A 14: 94,125,741 (GRCm39) P143L probably damaging Het
Pcsk6 A T 7: 65,577,035 (GRCm39) M158L possibly damaging Het
Pkd1 G T 17: 24,795,566 (GRCm39) probably null Het
Plk4 A T 3: 40,760,252 (GRCm39) S383C possibly damaging Het
Plxna2 T C 1: 194,326,297 (GRCm39) L77P probably damaging Het
Pnpla6 A T 8: 3,592,370 (GRCm39) T1209S probably benign Het
Prdm2 A G 4: 142,859,079 (GRCm39) S1404P possibly damaging Het
Preb T C 5: 31,116,157 (GRCm39) D150G probably damaging Het
Prrt2 A G 7: 126,617,902 (GRCm39) V59A probably benign Het
Prss40 T C 1: 34,597,095 (GRCm39) N151S possibly damaging Het
Ptprt G T 2: 161,400,818 (GRCm39) A1053D probably damaging Het
Ptprt A G 2: 161,608,241 (GRCm39) V685A possibly damaging Het
Rfx4 C T 10: 84,731,952 (GRCm39) S549F possibly damaging Het
Rnaset2b T A 17: 7,263,876 (GRCm39) V87E probably benign Het
Rnf213 G A 11: 119,331,933 (GRCm39) E2381K probably damaging Het
Sectm1a A T 11: 120,960,506 (GRCm39) I103N probably damaging Het
Selp T A 1: 163,970,327 (GRCm39) L597Q probably damaging Het
Sema6a T C 18: 47,433,209 (GRCm39) D74G probably damaging Het
Serpinb9b T C 13: 33,213,542 (GRCm39) V33A probably benign Het
Setd1b A T 5: 123,285,769 (GRCm39) T272S unknown Het
Sgf29 G C 7: 126,248,649 (GRCm39) probably null Het
Slc4a10 C A 2: 62,098,548 (GRCm39) Q561K probably damaging Het
Slc4a5 T C 6: 83,250,214 (GRCm39) I649T possibly damaging Het
Slc5a7 A G 17: 54,600,863 (GRCm39) Y91H probably damaging Het
Styxl1 T C 5: 135,785,976 (GRCm39) Y23C probably damaging Het
Tbc1d24 A G 17: 24,425,846 (GRCm39) V490A possibly damaging Het
Tbpl2 A T 2: 23,984,744 (GRCm39) F133L probably benign Het
Tnfrsf22 T C 7: 143,192,126 (GRCm39) probably benign Het
Top2b A G 14: 16,398,916 (GRCm38) E512G probably damaging Het
Trgc3 C A 13: 19,445,164 (GRCm39) F37L probably damaging Het
Ttc17 T A 2: 94,194,690 (GRCm39) H561L probably benign Het
Ttll4 G T 1: 74,724,527 (GRCm39) V566L possibly damaging Het
Ubqlnl A G 7: 103,797,692 (GRCm39) Y602H probably benign Het
Vmn1r231 T A 17: 21,110,212 (GRCm39) E234D probably damaging Het
Wbp11 A G 6: 136,797,583 (GRCm39) S279P probably damaging Het
Wdr6 A G 9: 108,453,733 (GRCm39) L50P probably damaging Het
Zfp715 A C 7: 42,948,073 (GRCm39) I629S possibly damaging Het
Other mutations in Ms4a18
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0556:Ms4a18 UTSW 19 10,991,065 (GRCm39) missense probably damaging 0.98
R2031:Ms4a18 UTSW 19 10,991,014 (GRCm39) missense probably benign 0.06
R2137:Ms4a18 UTSW 19 10,974,695 (GRCm39) missense possibly damaging 0.86
R2138:Ms4a18 UTSW 19 10,974,695 (GRCm39) missense possibly damaging 0.86
R2139:Ms4a18 UTSW 19 10,974,695 (GRCm39) missense possibly damaging 0.86
R2192:Ms4a18 UTSW 19 10,991,029 (GRCm39) missense probably benign 0.09
R2211:Ms4a18 UTSW 19 10,974,669 (GRCm39) missense probably benign 0.33
R3739:Ms4a18 UTSW 19 10,988,863 (GRCm39) missense probably damaging 1.00
R5586:Ms4a18 UTSW 19 10,991,038 (GRCm39) missense probably benign 0.00
R6102:Ms4a18 UTSW 19 10,990,887 (GRCm39) missense probably benign
R7091:Ms4a18 UTSW 19 10,986,092 (GRCm39) missense probably damaging 0.98
R7316:Ms4a18 UTSW 19 10,979,360 (GRCm39) missense probably damaging 1.00
R8162:Ms4a18 UTSW 19 10,991,071 (GRCm39) missense probably benign 0.00
R8854:Ms4a18 UTSW 19 10,990,887 (GRCm39) missense probably benign
R9098:Ms4a18 UTSW 19 10,990,741 (GRCm39) missense
R9157:Ms4a18 UTSW 19 10,988,804 (GRCm39) missense probably damaging 0.98
R9313:Ms4a18 UTSW 19 10,988,804 (GRCm39) missense probably damaging 0.98
R9583:Ms4a18 UTSW 19 10,974,714 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTGGTGAGTACTGGATTACTCC -3'
(R):5'- AGGCTTGCATTTTAGTGAAGAC -3'

Sequencing Primer
(F):5'- AGCCATTCCTGCTGAATACTGTAG -3'
(R):5'- GCTTGCATTTTAGTGAAGACAATAAC -3'
Posted On 2014-08-25