Incidental Mutation 'R1988:Kif21b'
ID222773
Institutional Source Beutler Lab
Gene Symbol Kif21b
Ensembl Gene ENSMUSG00000041642
Gene Namekinesin family member 21B
SynonymsN-5 kinesin, 2610511N21Rik
MMRRC Submission 040000-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R1988 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136131389-136177998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 136152264 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 513 (R513W)
Ref Sequence ENSEMBL: ENSMUSP00000074661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864]
Predicted Effect probably damaging
Transcript: ENSMUST00000075164
AA Change: R513W

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: R513W

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 3.81e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122892
Predicted Effect possibly damaging
Transcript: ENSMUST00000130864
AA Change: R513W

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: R513W

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 5.1e-6 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,896 D216V possibly damaging Het
2610021A01Rik C T 7: 41,626,657 R595* probably null Het
Adgrl3 A G 5: 81,688,567 D724G probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Akt1 T C 12: 112,655,151 I404V probably benign Het
Anxa13 T A 15: 58,341,948 noncoding transcript Het
Atoh1 T C 6: 64,729,633 V104A probably benign Het
Brwd1 T C 16: 96,021,237 D1256G probably damaging Het
C9 ATTTT ATTT 15: 6,483,138 probably null Het
Cd164 A G 10: 41,523,181 T89A probably benign Het
Cep350 G C 1: 155,933,104 N575K possibly damaging Het
Chrm5 A G 2: 112,480,252 V173A probably damaging Het
Cnot1 A G 8: 95,741,944 V1417A possibly damaging Het
Cntnap3 T C 13: 64,758,390 T801A probably damaging Het
Cntnap5b A C 1: 100,072,140 K208Q possibly damaging Het
Crx A T 7: 15,869,347 V107D possibly damaging Het
Csrnp2 A G 15: 100,489,440 F49S probably damaging Het
Ctbp1 A G 5: 33,250,904 L228P possibly damaging Het
Ctdp1 A T 18: 80,449,401 D626E possibly damaging Het
Cyp1a2 T C 9: 57,682,286 T82A possibly damaging Het
Dnah3 T A 7: 119,967,570 T2478S possibly damaging Het
Dnah3 T G 7: 119,967,959 D2348A probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 A G 6: 73,092,192 I2504T probably damaging Het
Dnase1l2 A C 17: 24,441,651 W138G probably damaging Het
Dopey2 T A 16: 93,766,173 I855N probably damaging Het
Dsc3 T A 18: 19,965,846 N759Y possibly damaging Het
Dtx2 C T 5: 136,032,293 R510* probably null Het
Fat4 G T 3: 38,887,115 M52I probably benign Het
Fat4 G A 3: 38,996,090 E4034K probably damaging Het
Fezf2 T C 14: 12,344,350 K279R probably damaging Het
Fsip2 G T 2: 82,976,517 W1060L possibly damaging Het
G6pc T A 11: 101,367,942 I49N probably damaging Het
Gars A G 6: 55,077,772 E688G probably null Het
Gdf11 T C 10: 128,885,242 N361S probably benign Het
Gli3 A C 13: 15,726,380 M1451L probably benign Het
Heatr3 T C 8: 88,150,317 I329T probably benign Het
Herc3 T G 6: 58,884,975 probably null Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Igsf3 A T 3: 101,431,296 I309F probably benign Het
Kif7 G T 7: 79,699,241 H1195Q probably benign Het
Lpcat4 T C 2: 112,242,542 V182A possibly damaging Het
Map3k21 T A 8: 125,927,555 I371N probably benign Het
Mns1 G A 9: 72,448,759 probably null Het
Myo3a A G 2: 22,578,128 T465A possibly damaging Het
Nlrc4 A T 17: 74,426,943 S992T probably benign Het
Notch4 G A 17: 34,587,588 G1833E possibly damaging Het
Olfr160 A T 9: 37,711,697 I194K possibly damaging Het
Olfr467 A T 7: 107,814,700 I39L probably benign Het
Olfr600 T A 7: 103,346,109 Y273F possibly damaging Het
Olfr666 T C 7: 104,892,903 T242A probably damaging Het
Olfr998 G A 2: 85,590,641 V34I probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pik3cd T A 4: 149,663,203 T28S probably damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Ppm1f T C 16: 16,923,666 S335P probably damaging Het
Prr16 C T 18: 51,303,277 P276L probably damaging Het
Rilp A G 11: 75,510,933 probably null Het
Rspry1 A G 8: 94,632,054 probably null Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Smyd5 T C 6: 85,438,136 I42T possibly damaging Het
Stk17b T C 1: 53,761,082 N246D probably damaging Het
Suco T C 1: 161,818,811 probably null Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tecpr1 C T 5: 144,204,697 V785M possibly damaging Het
Telo2 C T 17: 25,101,668 V756I probably benign Het
Tgm1 C T 14: 55,705,577 R602H probably benign Het
Timeless A G 10: 128,244,187 T402A probably damaging Het
Tnfaip2 T A 12: 111,449,891 probably null Het
Trim5 A G 7: 104,265,621 S414P probably damaging Het
Txnip A G 3: 96,559,750 T247A possibly damaging Het
Vmn1r174 A T 7: 23,754,625 T239S probably damaging Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Zranb3 A T 1: 127,959,743 N982K probably benign Het
Other mutations in Kif21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Kif21b APN 1 136152342 missense possibly damaging 0.68
IGL01020:Kif21b APN 1 136154094 splice site probably benign
IGL01288:Kif21b APN 1 136172184 missense probably benign 0.00
IGL02105:Kif21b APN 1 136171303 missense probably benign
IGL02264:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02303:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02308:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02310:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02419:Kif21b APN 1 136151267 missense probably benign 0.00
IGL02553:Kif21b APN 1 136154121 missense probably damaging 1.00
IGL02568:Kif21b APN 1 136172867 missense probably damaging 0.96
IGL02657:Kif21b APN 1 136172230 missense possibly damaging 0.88
IGL03068:Kif21b APN 1 136158355 unclassified probably benign
IGL03230:Kif21b APN 1 136162812 missense probably benign 0.03
R0190:Kif21b UTSW 1 136171219 missense probably benign 0.32
R0349:Kif21b UTSW 1 136149311 missense probably damaging 0.97
R0501:Kif21b UTSW 1 136163099 missense probably benign 0.44
R0620:Kif21b UTSW 1 136159428 missense possibly damaging 0.88
R0629:Kif21b UTSW 1 136172157 critical splice acceptor site probably null
R0741:Kif21b UTSW 1 136159744 missense probably damaging 1.00
R1087:Kif21b UTSW 1 136162823 missense probably damaging 1.00
R1217:Kif21b UTSW 1 136152376 missense probably damaging 1.00
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1511:Kif21b UTSW 1 136169324 critical splice donor site probably null
R1512:Kif21b UTSW 1 136152805 missense probably benign 0.01
R1513:Kif21b UTSW 1 136156111 missense probably damaging 0.98
R1591:Kif21b UTSW 1 136149317 missense probably damaging 1.00
R1616:Kif21b UTSW 1 136171685 missense probably damaging 1.00
R1628:Kif21b UTSW 1 136171220 missense probably benign 0.01
R1658:Kif21b UTSW 1 136171285 missense probably damaging 1.00
R1728:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1741:Kif21b UTSW 1 136156142 missense probably damaging 1.00
R1784:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1807:Kif21b UTSW 1 136147793 missense possibly damaging 0.94
R1896:Kif21b UTSW 1 136147845 missense possibly damaging 0.90
R1970:Kif21b UTSW 1 136171156 missense probably damaging 1.00
R1984:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1985:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1986:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1990:Kif21b UTSW 1 136161770 missense probably damaging 1.00
R2014:Kif21b UTSW 1 136148282 missense probably damaging 1.00
R2045:Kif21b UTSW 1 136160313 missense probably damaging 1.00
R2141:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R2248:Kif21b UTSW 1 136172966 missense probably damaging 1.00
R2886:Kif21b UTSW 1 136147874 splice site probably benign
R2896:Kif21b UTSW 1 136154217 missense possibly damaging 0.82
R3706:Kif21b UTSW 1 136159410 missense probably benign 0.06
R3780:Kif21b UTSW 1 136156226 missense probably damaging 0.99
R3827:Kif21b UTSW 1 136162994 critical splice donor site probably null
R4227:Kif21b UTSW 1 136154093 splice site probably null
R4600:Kif21b UTSW 1 136147864 missense probably benign 0.39
R4608:Kif21b UTSW 1 136148186 intron probably benign
R4749:Kif21b UTSW 1 136144749 nonsense probably null
R4841:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4842:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4933:Kif21b UTSW 1 136151325 splice site probably null
R4959:Kif21b UTSW 1 136148370 missense possibly damaging 0.90
R5018:Kif21b UTSW 1 136172234 missense probably benign 0.30
R5116:Kif21b UTSW 1 136152783 missense probably damaging 0.99
R5119:Kif21b UTSW 1 136163100 missense probably benign
R5197:Kif21b UTSW 1 136144625 missense probably damaging 1.00
R5230:Kif21b UTSW 1 136171673 missense probably damaging 1.00
R5249:Kif21b UTSW 1 136169228 missense probably damaging 1.00
R5337:Kif21b UTSW 1 136171143 missense probably damaging 1.00
R5358:Kif21b UTSW 1 136172292 missense possibly damaging 0.85
R5466:Kif21b UTSW 1 136147525 missense probably damaging 1.00
R5557:Kif21b UTSW 1 136170059 missense probably damaging 1.00
R5727:Kif21b UTSW 1 136170009 missense probably damaging 1.00
R5865:Kif21b UTSW 1 136151137 nonsense probably null
R5929:Kif21b UTSW 1 136151207 missense probably damaging 1.00
R6274:Kif21b UTSW 1 136149418 missense possibly damaging 0.57
R6349:Kif21b UTSW 1 136158326 missense probably damaging 1.00
R6648:Kif21b UTSW 1 136152397 missense probably benign 0.00
R6831:Kif21b UTSW 1 136144758 nonsense probably null
R7156:Kif21b UTSW 1 136147824 missense probably damaging 1.00
R7165:Kif21b UTSW 1 136149448 missense probably damaging 0.98
R7327:Kif21b UTSW 1 136159649 missense possibly damaging 0.60
R7680:Kif21b UTSW 1 136147869 critical splice donor site probably null
RF024:Kif21b UTSW 1 136158341 missense probably damaging 1.00
X0053:Kif21b UTSW 1 136149316 missense probably damaging 1.00
X0066:Kif21b UTSW 1 136172945 missense probably damaging 1.00
Z1176:Kif21b UTSW 1 136154137 missense probably benign 0.00
Z1177:Kif21b UTSW 1 136148312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGCTCTGATCCAGAACTAC -3'
(R):5'- CCTTCAAATGTTCTGGTGTCAGG -3'

Sequencing Primer
(F):5'- GTGCTCTGATCCAGAACTACATCCG -3'
(R):5'- TCAGGGGTGGTAGTAACATTCCAC -3'
Posted On2014-08-25