Mutagenetix > Incidental Mutations

Incidental Mutation 'R1988:Kif21b'

222773

Institutional Source

Beutler Lab

Gene Symbol

Kif21b

Ensembl Gene

ENSMUSG00000041642

Gene Name

kinesin family member 21B

Synonyms

N-5 kinesin, 2610511N21Rik

MMRRC Submission

040000-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R1988 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136131389-136177998 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 136152264 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 513 (R513W)

Ref Sequence

ENSEMBL: ENSMUSP00000074661 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864]

Predicted Effect

probably damaging
Transcript: ENSMUST00000075164
AA Change: R513W

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: R513W

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	3.81e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122892

Predicted Effect

possibly damaging
Transcript: ENSMUST00000130864
AA Change: R513W

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: R513W

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	5.1e-6	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.1%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	A	6: 146,952,896	D216V	possibly damaging	Het
2610021A01Rik	C	T	7: 41,626,657	R595*	probably null	Het
Adgrl3	A	G	5: 81,688,567	D724G	probably damaging	Het
Akap6	T	C	12: 53,140,795	F1664S	possibly damaging	Het
Akt1	T	C	12: 112,655,151	I404V	probably benign	Het
Anxa13	T	A	15: 58,341,948		noncoding transcript	Het
Atoh1	T	C	6: 64,729,633	V104A	probably benign	Het
Brwd1	T	C	16: 96,021,237	D1256G	probably damaging	Het
C9	ATTTT	ATTT	15: 6,483,138		probably null	Het
Cd164	A	G	10: 41,523,181	T89A	probably benign	Het
Cep350	G	C	1: 155,933,104	N575K	possibly damaging	Het
Chrm5	A	G	2: 112,480,252	V173A	probably damaging	Het
Cnot1	A	G	8: 95,741,944	V1417A	possibly damaging	Het
Cntnap3	T	C	13: 64,758,390	T801A	probably damaging	Het
Cntnap5b	A	C	1: 100,072,140	K208Q	possibly damaging	Het
Crx	A	T	7: 15,869,347	V107D	possibly damaging	Het
Csrnp2	A	G	15: 100,489,440	F49S	probably damaging	Het
Ctbp1	A	G	5: 33,250,904	L228P	possibly damaging	Het
Ctdp1	A	T	18: 80,449,401	D626E	possibly damaging	Het
Cyp1a2	T	C	9: 57,682,286	T82A	possibly damaging	Het
Dnah3	T	A	7: 119,967,570	T2478S	possibly damaging	Het
Dnah3	T	G	7: 119,967,959	D2348A	probably damaging	Het
Dnah5	T	C	15: 28,343,591	I2379T	probably damaging	Het
Dnah6	A	G	6: 73,092,192	I2504T	probably damaging	Het
Dnase1l2	A	C	17: 24,441,651	W138G	probably damaging	Het
Dopey2	T	A	16: 93,766,173	I855N	probably damaging	Het
Dsc3	T	A	18: 19,965,846	N759Y	possibly damaging	Het
Dtx2	C	T	5: 136,032,293	R510*	probably null	Het
Fat4	G	T	3: 38,887,115	M52I	probably benign	Het
Fat4	G	A	3: 38,996,090	E4034K	probably damaging	Het
Fezf2	T	C	14: 12,344,350	K279R	probably damaging	Het
Fsip2	G	T	2: 82,976,517	W1060L	possibly damaging	Het
G6pc	T	A	11: 101,367,942	I49N	probably damaging	Het
Gars	A	G	6: 55,077,772	E688G	probably null	Het
Gdf11	T	C	10: 128,885,242	N361S	probably benign	Het
Gli3	A	C	13: 15,726,380	M1451L	probably benign	Het
Heatr3	T	C	8: 88,150,317	I329T	probably benign	Het
Herc3	T	G	6: 58,884,975		probably null	Het
Hrnr	A	G	3: 93,332,604	N3383S	unknown	Het
Igsf3	A	T	3: 101,431,296	I309F	probably benign	Het
Kif7	G	T	7: 79,699,241	H1195Q	probably benign	Het
Lpcat4	T	C	2: 112,242,542	V182A	possibly damaging	Het
Map3k21	T	A	8: 125,927,555	I371N	probably benign	Het
Mns1	G	A	9: 72,448,759		probably null	Het
Myo3a	A	G	2: 22,578,128	T465A	possibly damaging	Het
Nlrc4	A	T	17: 74,426,943	S992T	probably benign	Het
Notch4	G	A	17: 34,587,588	G1833E	possibly damaging	Het
Olfr160	A	T	9: 37,711,697	I194K	possibly damaging	Het
Olfr467	A	T	7: 107,814,700	I39L	probably benign	Het
Olfr600	T	A	7: 103,346,109	Y273F	possibly damaging	Het
Olfr666	T	C	7: 104,892,903	T242A	probably damaging	Het
Olfr998	G	A	2: 85,590,641	V34I	probably benign	Het
Pcdh9	G	A	14: 93,888,305	P143L	probably damaging	Het
Pik3cd	T	A	4: 149,663,203	T28S	probably damaging	Het
Pkd1	G	T	17: 24,576,592		probably null	Het
Plk4	A	T	3: 40,805,817	S383C	possibly damaging	Het
Plxna2	T	C	1: 194,643,989	L77P	probably damaging	Het
Ppm1f	T	C	16: 16,923,666	S335P	probably damaging	Het
Prr16	C	T	18: 51,303,277	P276L	probably damaging	Het
Rilp	A	G	11: 75,510,933		probably null	Het
Rspry1	A	G	8: 94,632,054		probably null	Het
Serpinb9b	T	C	13: 33,029,559	V33A	probably benign	Het
Slc4a10	C	A	2: 62,268,204	Q561K	probably damaging	Het
Smyd5	T	C	6: 85,438,136	I42T	possibly damaging	Het
Stk17b	T	C	1: 53,761,082	N246D	probably damaging	Het
Suco	T	C	1: 161,818,811		probably null	Het
Tcrg-C3	C	A	13: 19,260,994	F37L	probably damaging	Het
Tecpr1	C	T	5: 144,204,697	V785M	possibly damaging	Het
Telo2	C	T	17: 25,101,668	V756I	probably benign	Het
Tgm1	C	T	14: 55,705,577	R602H	probably benign	Het
Timeless	A	G	10: 128,244,187	T402A	probably damaging	Het
Tnfaip2	T	A	12: 111,449,891		probably null	Het
Trim5	A	G	7: 104,265,621	S414P	probably damaging	Het
Txnip	A	G	3: 96,559,750	T247A	possibly damaging	Het
Vmn1r174	A	T	7: 23,754,625	T239S	probably damaging	Het
Vmn1r231	T	A	17: 20,889,950	E234D	probably damaging	Het
Zranb3	A	T	1: 127,959,743	N982K	probably benign	Het

Other mutations in Kif21b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Kif21b	APN	1	136152342	missense	possibly damaging	0.68
IGL01020:Kif21b	APN	1	136154094	splice site	probably benign
IGL01288:Kif21b	APN	1	136172184	missense	probably benign	0.00
IGL02105:Kif21b	APN	1	136171303	missense	probably benign
IGL02264:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02303:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02308:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02310:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02419:Kif21b	APN	1	136151267	missense	probably benign	0.00
IGL02553:Kif21b	APN	1	136154121	missense	probably damaging	1.00
IGL02568:Kif21b	APN	1	136172867	missense	probably damaging	0.96
IGL02657:Kif21b	APN	1	136172230	missense	possibly damaging	0.88
IGL03068:Kif21b	APN	1	136158355	unclassified	probably benign
IGL03230:Kif21b	APN	1	136162812	missense	probably benign	0.03
R0190:Kif21b	UTSW	1	136171219	missense	probably benign	0.32
R0349:Kif21b	UTSW	1	136149311	missense	probably damaging	0.97
R0501:Kif21b	UTSW	1	136163099	missense	probably benign	0.44
R0620:Kif21b	UTSW	1	136159428	missense	possibly damaging	0.88
R0629:Kif21b	UTSW	1	136172157	critical splice acceptor site	probably null
R0741:Kif21b	UTSW	1	136159744	missense	probably damaging	1.00
R1087:Kif21b	UTSW	1	136162823	missense	probably damaging	1.00
R1217:Kif21b	UTSW	1	136152376	missense	probably damaging	1.00
R1464:Kif21b	UTSW	1	136156153	missense	possibly damaging	0.50
R1464:Kif21b	UTSW	1	136156153	missense	possibly damaging	0.50
R1511:Kif21b	UTSW	1	136169324	critical splice donor site	probably null
R1512:Kif21b	UTSW	1	136152805	missense	probably benign	0.01
R1513:Kif21b	UTSW	1	136156111	missense	probably damaging	0.98
R1591:Kif21b	UTSW	1	136149317	missense	probably damaging	1.00
R1616:Kif21b	UTSW	1	136171685	missense	probably damaging	1.00
R1628:Kif21b	UTSW	1	136171220	missense	probably benign	0.01
R1658:Kif21b	UTSW	1	136171285	missense	probably damaging	1.00
R1728:Kif21b	UTSW	1	136160121	missense	possibly damaging	0.85
R1741:Kif21b	UTSW	1	136156142	missense	probably damaging	1.00
R1784:Kif21b	UTSW	1	136160121	missense	possibly damaging	0.85
R1807:Kif21b	UTSW	1	136147793	missense	possibly damaging	0.94
R1896:Kif21b	UTSW	1	136147845	missense	possibly damaging	0.90
R1970:Kif21b	UTSW	1	136171156	missense	probably damaging	1.00
R1984:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1985:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1986:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1990:Kif21b	UTSW	1	136161770	missense	probably damaging	1.00
R2014:Kif21b	UTSW	1	136148282	missense	probably damaging	1.00
R2045:Kif21b	UTSW	1	136160313	missense	probably damaging	1.00
R2141:Kif21b	UTSW	1	136152264	missense	probably damaging	0.98
R2248:Kif21b	UTSW	1	136172966	missense	probably damaging	1.00
R2886:Kif21b	UTSW	1	136147874	splice site	probably benign
R2896:Kif21b	UTSW	1	136154217	missense	possibly damaging	0.82
R3706:Kif21b	UTSW	1	136159410	missense	probably benign	0.06
R3780:Kif21b	UTSW	1	136156226	missense	probably damaging	0.99
R3827:Kif21b	UTSW	1	136162994	critical splice donor site	probably null
R4227:Kif21b	UTSW	1	136154093	splice site	probably null
R4600:Kif21b	UTSW	1	136147864	missense	probably benign	0.39
R4608:Kif21b	UTSW	1	136148186	intron	probably benign
R4749:Kif21b	UTSW	1	136144749	nonsense	probably null
R4841:Kif21b	UTSW	1	136145220	missense	probably damaging	1.00
R4842:Kif21b	UTSW	1	136145220	missense	probably damaging	1.00
R4933:Kif21b	UTSW	1	136151325	splice site	probably null
R4959:Kif21b	UTSW	1	136148370	missense	possibly damaging	0.90
R5018:Kif21b	UTSW	1	136172234	missense	probably benign	0.30
R5116:Kif21b	UTSW	1	136152783	missense	probably damaging	0.99
R5119:Kif21b	UTSW	1	136163100	missense	probably benign
R5197:Kif21b	UTSW	1	136144625	missense	probably damaging	1.00
R5230:Kif21b	UTSW	1	136171673	missense	probably damaging	1.00
R5249:Kif21b	UTSW	1	136169228	missense	probably damaging	1.00
R5337:Kif21b	UTSW	1	136171143	missense	probably damaging	1.00
R5358:Kif21b	UTSW	1	136172292	missense	possibly damaging	0.85
R5466:Kif21b	UTSW	1	136147525	missense	probably damaging	1.00
R5557:Kif21b	UTSW	1	136170059	missense	probably damaging	1.00
R5727:Kif21b	UTSW	1	136170009	missense	probably damaging	1.00
R5865:Kif21b	UTSW	1	136151137	nonsense	probably null
R5929:Kif21b	UTSW	1	136151207	missense	probably damaging	1.00
R6274:Kif21b	UTSW	1	136149418	missense	possibly damaging	0.57
R6349:Kif21b	UTSW	1	136158326	missense	probably damaging	1.00
R6648:Kif21b	UTSW	1	136152397	missense	probably benign	0.00
R6831:Kif21b	UTSW	1	136144758	nonsense	probably null
R7156:Kif21b	UTSW	1	136147824	missense	probably damaging	1.00
R7165:Kif21b	UTSW	1	136149448	missense	probably damaging	0.98
R7327:Kif21b	UTSW	1	136159649	missense	possibly damaging	0.60
R7680:Kif21b	UTSW	1	136147869	critical splice donor site	probably null
RF024:Kif21b	UTSW	1	136158341	missense	probably damaging	1.00
X0053:Kif21b	UTSW	1	136149316	missense	probably damaging	1.00
X0066:Kif21b	UTSW	1	136172945	missense	probably damaging	1.00
Z1176:Kif21b	UTSW	1	136154137	missense	probably benign	0.00
Z1177:Kif21b	UTSW	1	136148312	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTGCTCTGATCCAGAACTAC -3'
(R):5'- CCTTCAAATGTTCTGGTGTCAGG -3'

Sequencing Primer
(F):5'- GTGCTCTGATCCAGAACTACATCCG -3'
(R):5'- TCAGGGGTGGTAGTAACATTCCAC -3'

Posted On

2014-08-25