Incidental Mutation 'R1988:Kif21b'
ID 222773
Institutional Source Beutler Lab
Gene Symbol Kif21b
Ensembl Gene ENSMUSG00000041642
Gene Name kinesin family member 21B
Synonyms 2610511N21Rik, N-5 kinesin
MMRRC Submission 040000-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R1988 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 136059127-136105736 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 136080002 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 513 (R513W)
Ref Sequence ENSEMBL: ENSMUSP00000074661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000075164
AA Change: R513W

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: R513W

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 3.81e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122892
Predicted Effect possibly damaging
Transcript: ENSMUST00000130864
AA Change: R513W

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: R513W

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 5.1e-6 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,854,394 (GRCm39) D216V possibly damaging Het
2610021A01Rik C T 7: 41,276,081 (GRCm39) R595* probably null Het
Adgrl3 A G 5: 81,836,414 (GRCm39) D724G probably damaging Het
Akap6 T C 12: 53,187,578 (GRCm39) F1664S possibly damaging Het
Akt1 T C 12: 112,621,585 (GRCm39) I404V probably benign Het
Anxa13 T A 15: 58,205,344 (GRCm39) noncoding transcript Het
Atoh1 T C 6: 64,706,617 (GRCm39) V104A probably benign Het
Brwd1 T C 16: 95,822,437 (GRCm39) D1256G probably damaging Het
C9 ATTTT ATTT 15: 6,512,619 (GRCm39) probably null Het
Cd164 A G 10: 41,399,177 (GRCm39) T89A probably benign Het
Cep350 G C 1: 155,808,850 (GRCm39) N575K possibly damaging Het
Chrm5 A G 2: 112,310,597 (GRCm39) V173A probably damaging Het
Cnot1 A G 8: 96,468,572 (GRCm39) V1417A possibly damaging Het
Cntnap3 T C 13: 64,906,204 (GRCm39) T801A probably damaging Het
Cntnap5b A C 1: 99,999,865 (GRCm39) K208Q possibly damaging Het
Crx A T 7: 15,603,272 (GRCm39) V107D possibly damaging Het
Csrnp2 A G 15: 100,387,321 (GRCm39) F49S probably damaging Het
Ctbp1 A G 5: 33,408,248 (GRCm39) L228P possibly damaging Het
Ctdp1 A T 18: 80,492,616 (GRCm39) D626E possibly damaging Het
Cyp1a2 T C 9: 57,589,569 (GRCm39) T82A possibly damaging Het
Dnah3 T A 7: 119,566,793 (GRCm39) T2478S possibly damaging Het
Dnah3 T G 7: 119,567,182 (GRCm39) D2348A probably damaging Het
Dnah5 T C 15: 28,343,737 (GRCm39) I2379T probably damaging Het
Dnah6 A G 6: 73,069,175 (GRCm39) I2504T probably damaging Het
Dnase1l2 A C 17: 24,660,625 (GRCm39) W138G probably damaging Het
Dop1b T A 16: 93,563,061 (GRCm39) I855N probably damaging Het
Dsc3 T A 18: 20,098,903 (GRCm39) N759Y possibly damaging Het
Dtx2 C T 5: 136,061,147 (GRCm39) R510* probably null Het
Fat4 G T 3: 38,941,264 (GRCm39) M52I probably benign Het
Fat4 G A 3: 39,050,239 (GRCm39) E4034K probably damaging Het
Fezf2 T C 14: 12,344,350 (GRCm38) K279R probably damaging Het
Fsip2 G T 2: 82,806,861 (GRCm39) W1060L possibly damaging Het
G6pc1 T A 11: 101,258,768 (GRCm39) I49N probably damaging Het
Gars1 A G 6: 55,054,757 (GRCm39) E688G probably null Het
Gdf11 T C 10: 128,721,111 (GRCm39) N361S probably benign Het
Gli3 A C 13: 15,900,965 (GRCm39) M1451L probably benign Het
Heatr3 T C 8: 88,876,945 (GRCm39) I329T probably benign Het
Herc3 T G 6: 58,861,960 (GRCm39) probably null Het
Hrnr A G 3: 93,239,911 (GRCm39) N3383S unknown Het
Igsf3 A T 3: 101,338,612 (GRCm39) I309F probably benign Het
Kif7 G T 7: 79,348,989 (GRCm39) H1195Q probably benign Het
Lpcat4 T C 2: 112,072,887 (GRCm39) V182A possibly damaging Het
Map3k21 T A 8: 126,654,294 (GRCm39) I371N probably benign Het
Mns1 G A 9: 72,356,041 (GRCm39) probably null Het
Myo3a A G 2: 22,468,140 (GRCm39) T465A possibly damaging Het
Nlrc4 A T 17: 74,733,938 (GRCm39) S992T probably benign Het
Notch4 G A 17: 34,806,562 (GRCm39) G1833E possibly damaging Het
Or52ad1 T A 7: 102,995,316 (GRCm39) Y273F possibly damaging Het
Or52n2 T C 7: 104,542,110 (GRCm39) T242A probably damaging Het
Or5g29 G A 2: 85,420,985 (GRCm39) V34I probably benign Het
Or5p5 A T 7: 107,413,907 (GRCm39) I39L probably benign Het
Or8a1b A T 9: 37,622,993 (GRCm39) I194K possibly damaging Het
Pcdh9 G A 14: 94,125,741 (GRCm39) P143L probably damaging Het
Pik3cd T A 4: 149,747,660 (GRCm39) T28S probably damaging Het
Pkd1 G T 17: 24,795,566 (GRCm39) probably null Het
Plk4 A T 3: 40,760,252 (GRCm39) S383C possibly damaging Het
Plxna2 T C 1: 194,326,297 (GRCm39) L77P probably damaging Het
Ppm1f T C 16: 16,741,530 (GRCm39) S335P probably damaging Het
Prr16 C T 18: 51,436,349 (GRCm39) P276L probably damaging Het
Rilp A G 11: 75,401,759 (GRCm39) probably null Het
Rspry1 A G 8: 95,358,682 (GRCm39) probably null Het
Serpinb9b T C 13: 33,213,542 (GRCm39) V33A probably benign Het
Slc4a10 C A 2: 62,098,548 (GRCm39) Q561K probably damaging Het
Smyd5 T C 6: 85,415,118 (GRCm39) I42T possibly damaging Het
Stk17b T C 1: 53,800,241 (GRCm39) N246D probably damaging Het
Suco T C 1: 161,646,380 (GRCm39) probably null Het
Tecpr1 C T 5: 144,141,515 (GRCm39) V785M possibly damaging Het
Telo2 C T 17: 25,320,642 (GRCm39) V756I probably benign Het
Tgm1 C T 14: 55,943,034 (GRCm39) R602H probably benign Het
Timeless A G 10: 128,080,056 (GRCm39) T402A probably damaging Het
Tnfaip2 T A 12: 111,416,325 (GRCm39) probably null Het
Trgc3 C A 13: 19,445,164 (GRCm39) F37L probably damaging Het
Trim5 A G 7: 103,914,828 (GRCm39) S414P probably damaging Het
Txnip A G 3: 96,467,066 (GRCm39) T247A possibly damaging Het
Vmn1r174 A T 7: 23,454,050 (GRCm39) T239S probably damaging Het
Vmn1r231 T A 17: 21,110,212 (GRCm39) E234D probably damaging Het
Zranb3 A T 1: 127,887,480 (GRCm39) N982K probably benign Het
Other mutations in Kif21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Kif21b APN 1 136,080,080 (GRCm39) missense possibly damaging 0.68
IGL01020:Kif21b APN 1 136,081,832 (GRCm39) splice site probably benign
IGL01288:Kif21b APN 1 136,099,922 (GRCm39) missense probably benign 0.00
IGL02105:Kif21b APN 1 136,099,041 (GRCm39) missense probably benign
IGL02264:Kif21b APN 1 136,087,495 (GRCm39) missense probably damaging 1.00
IGL02303:Kif21b APN 1 136,087,495 (GRCm39) missense probably damaging 1.00
IGL02308:Kif21b APN 1 136,087,495 (GRCm39) missense probably damaging 1.00
IGL02310:Kif21b APN 1 136,087,495 (GRCm39) missense probably damaging 1.00
IGL02419:Kif21b APN 1 136,079,005 (GRCm39) missense probably benign 0.00
IGL02553:Kif21b APN 1 136,081,859 (GRCm39) missense probably damaging 1.00
IGL02568:Kif21b APN 1 136,100,605 (GRCm39) missense probably damaging 0.96
IGL02657:Kif21b APN 1 136,099,968 (GRCm39) missense possibly damaging 0.88
IGL03068:Kif21b APN 1 136,086,093 (GRCm39) unclassified probably benign
IGL03230:Kif21b APN 1 136,090,550 (GRCm39) missense probably benign 0.03
R0629_Kif21b_729 UTSW 1 136,099,895 (GRCm39) critical splice acceptor site probably null
Schiessen UTSW 1 136,075,607 (GRCm39) critical splice donor site probably null
wolfen UTSW 1 136,072,496 (GRCm39) nonsense probably null
R0190:Kif21b UTSW 1 136,098,957 (GRCm39) missense probably benign 0.32
R0349:Kif21b UTSW 1 136,077,049 (GRCm39) missense probably damaging 0.97
R0501:Kif21b UTSW 1 136,090,837 (GRCm39) missense probably benign 0.44
R0620:Kif21b UTSW 1 136,087,166 (GRCm39) missense possibly damaging 0.88
R0629:Kif21b UTSW 1 136,099,895 (GRCm39) critical splice acceptor site probably null
R0741:Kif21b UTSW 1 136,087,482 (GRCm39) missense probably damaging 1.00
R1087:Kif21b UTSW 1 136,090,561 (GRCm39) missense probably damaging 1.00
R1217:Kif21b UTSW 1 136,080,114 (GRCm39) missense probably damaging 1.00
R1464:Kif21b UTSW 1 136,083,891 (GRCm39) missense possibly damaging 0.50
R1464:Kif21b UTSW 1 136,083,891 (GRCm39) missense possibly damaging 0.50
R1511:Kif21b UTSW 1 136,097,062 (GRCm39) critical splice donor site probably null
R1512:Kif21b UTSW 1 136,080,543 (GRCm39) missense probably benign 0.01
R1513:Kif21b UTSW 1 136,083,849 (GRCm39) missense probably damaging 0.98
R1591:Kif21b UTSW 1 136,077,055 (GRCm39) missense probably damaging 1.00
R1616:Kif21b UTSW 1 136,099,423 (GRCm39) missense probably damaging 1.00
R1628:Kif21b UTSW 1 136,098,958 (GRCm39) missense probably benign 0.01
R1658:Kif21b UTSW 1 136,099,023 (GRCm39) missense probably damaging 1.00
R1728:Kif21b UTSW 1 136,087,859 (GRCm39) missense possibly damaging 0.85
R1741:Kif21b UTSW 1 136,083,880 (GRCm39) missense probably damaging 1.00
R1784:Kif21b UTSW 1 136,087,859 (GRCm39) missense possibly damaging 0.85
R1807:Kif21b UTSW 1 136,075,531 (GRCm39) missense possibly damaging 0.94
R1896:Kif21b UTSW 1 136,075,583 (GRCm39) missense possibly damaging 0.90
R1970:Kif21b UTSW 1 136,098,894 (GRCm39) missense probably damaging 1.00
R1984:Kif21b UTSW 1 136,075,284 (GRCm39) missense probably damaging 1.00
R1985:Kif21b UTSW 1 136,075,284 (GRCm39) missense probably damaging 1.00
R1986:Kif21b UTSW 1 136,075,284 (GRCm39) missense probably damaging 1.00
R1990:Kif21b UTSW 1 136,089,508 (GRCm39) missense probably damaging 1.00
R2014:Kif21b UTSW 1 136,076,020 (GRCm39) missense probably damaging 1.00
R2045:Kif21b UTSW 1 136,088,051 (GRCm39) missense probably damaging 1.00
R2141:Kif21b UTSW 1 136,080,002 (GRCm39) missense probably damaging 0.98
R2248:Kif21b UTSW 1 136,100,704 (GRCm39) missense probably damaging 1.00
R2886:Kif21b UTSW 1 136,075,612 (GRCm39) splice site probably benign
R2896:Kif21b UTSW 1 136,081,955 (GRCm39) missense possibly damaging 0.82
R3706:Kif21b UTSW 1 136,087,148 (GRCm39) missense probably benign 0.06
R3780:Kif21b UTSW 1 136,083,964 (GRCm39) missense probably damaging 0.99
R3827:Kif21b UTSW 1 136,090,732 (GRCm39) critical splice donor site probably null
R4227:Kif21b UTSW 1 136,081,831 (GRCm39) splice site probably null
R4600:Kif21b UTSW 1 136,075,602 (GRCm39) missense probably benign 0.39
R4608:Kif21b UTSW 1 136,075,924 (GRCm39) intron probably benign
R4749:Kif21b UTSW 1 136,072,487 (GRCm39) nonsense probably null
R4841:Kif21b UTSW 1 136,072,958 (GRCm39) missense probably damaging 1.00
R4842:Kif21b UTSW 1 136,072,958 (GRCm39) missense probably damaging 1.00
R4933:Kif21b UTSW 1 136,079,063 (GRCm39) splice site probably null
R4959:Kif21b UTSW 1 136,076,108 (GRCm39) missense possibly damaging 0.90
R5018:Kif21b UTSW 1 136,099,972 (GRCm39) missense probably benign 0.30
R5116:Kif21b UTSW 1 136,080,521 (GRCm39) missense probably damaging 0.99
R5119:Kif21b UTSW 1 136,090,838 (GRCm39) missense probably benign
R5197:Kif21b UTSW 1 136,072,363 (GRCm39) missense probably damaging 1.00
R5230:Kif21b UTSW 1 136,099,411 (GRCm39) missense probably damaging 1.00
R5249:Kif21b UTSW 1 136,096,966 (GRCm39) missense probably damaging 1.00
R5337:Kif21b UTSW 1 136,098,881 (GRCm39) missense probably damaging 1.00
R5358:Kif21b UTSW 1 136,100,030 (GRCm39) missense possibly damaging 0.85
R5466:Kif21b UTSW 1 136,075,263 (GRCm39) missense probably damaging 1.00
R5557:Kif21b UTSW 1 136,097,797 (GRCm39) missense probably damaging 1.00
R5727:Kif21b UTSW 1 136,097,747 (GRCm39) missense probably damaging 1.00
R5865:Kif21b UTSW 1 136,078,875 (GRCm39) nonsense probably null
R5929:Kif21b UTSW 1 136,078,945 (GRCm39) missense probably damaging 1.00
R6274:Kif21b UTSW 1 136,077,156 (GRCm39) missense possibly damaging 0.57
R6349:Kif21b UTSW 1 136,086,064 (GRCm39) missense probably damaging 1.00
R6648:Kif21b UTSW 1 136,080,135 (GRCm39) missense probably benign 0.00
R6831:Kif21b UTSW 1 136,072,496 (GRCm39) nonsense probably null
R7156:Kif21b UTSW 1 136,075,562 (GRCm39) missense probably damaging 1.00
R7165:Kif21b UTSW 1 136,077,186 (GRCm39) missense probably damaging 0.98
R7327:Kif21b UTSW 1 136,087,387 (GRCm39) missense possibly damaging 0.60
R7680:Kif21b UTSW 1 136,075,607 (GRCm39) critical splice donor site probably null
R7975:Kif21b UTSW 1 136,098,911 (GRCm39) missense probably damaging 1.00
R8356:Kif21b UTSW 1 136,100,683 (GRCm39) missense probably damaging 1.00
R8467:Kif21b UTSW 1 136,100,021 (GRCm39) missense probably damaging 0.98
R9031:Kif21b UTSW 1 136,073,042 (GRCm39) missense probably damaging 0.99
R9101:Kif21b UTSW 1 136,078,893 (GRCm39) missense probably damaging 0.96
R9191:Kif21b UTSW 1 136,100,559 (GRCm39) nonsense probably null
R9261:Kif21b UTSW 1 136,077,162 (GRCm39) missense probably damaging 1.00
R9280:Kif21b UTSW 1 136,099,445 (GRCm39) critical splice donor site probably null
R9307:Kif21b UTSW 1 136,101,800 (GRCm39) missense probably benign
R9562:Kif21b UTSW 1 136,077,090 (GRCm39) missense probably damaging 0.99
R9563:Kif21b UTSW 1 136,077,166 (GRCm39) missense probably damaging 1.00
R9565:Kif21b UTSW 1 136,077,090 (GRCm39) missense probably damaging 0.99
R9758:Kif21b UTSW 1 136,080,961 (GRCm39) missense probably damaging 1.00
R9760:Kif21b UTSW 1 136,076,421 (GRCm39) missense probably damaging 1.00
RF024:Kif21b UTSW 1 136,086,079 (GRCm39) missense probably damaging 1.00
X0053:Kif21b UTSW 1 136,077,054 (GRCm39) missense probably damaging 1.00
X0066:Kif21b UTSW 1 136,100,683 (GRCm39) missense probably damaging 1.00
Z1176:Kif21b UTSW 1 136,081,875 (GRCm39) missense probably benign 0.00
Z1177:Kif21b UTSW 1 136,076,050 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGCTCTGATCCAGAACTAC -3'
(R):5'- CCTTCAAATGTTCTGGTGTCAGG -3'

Sequencing Primer
(F):5'- GTGCTCTGATCCAGAACTACATCCG -3'
(R):5'- TCAGGGGTGGTAGTAACATTCCAC -3'
Posted On 2014-08-25