Incidental Mutation 'R1988:Cep350'
ID222775
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Namecentrosomal protein 350
Synonyms6430546F08Rik, 4933409L06Rik
MMRRC Submission 040000-MU
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R1988 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location155844964-155973255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 155933104 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 575 (N575K)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124495] [ENSMUST00000138762]
Predicted Effect probably benign
Transcript: ENSMUST00000124495
Predicted Effect possibly damaging
Transcript: ENSMUST00000138762
AA Change: N575K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: N575K

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,896 D216V possibly damaging Het
2610021A01Rik C T 7: 41,626,657 R595* probably null Het
Adgrl3 A G 5: 81,688,567 D724G probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Akt1 T C 12: 112,655,151 I404V probably benign Het
Anxa13 T A 15: 58,341,948 noncoding transcript Het
Atoh1 T C 6: 64,729,633 V104A probably benign Het
Brwd1 T C 16: 96,021,237 D1256G probably damaging Het
C9 ATTTT ATTT 15: 6,483,138 probably null Het
Cd164 A G 10: 41,523,181 T89A probably benign Het
Chrm5 A G 2: 112,480,252 V173A probably damaging Het
Cnot1 A G 8: 95,741,944 V1417A possibly damaging Het
Cntnap3 T C 13: 64,758,390 T801A probably damaging Het
Cntnap5b A C 1: 100,072,140 K208Q possibly damaging Het
Crx A T 7: 15,869,347 V107D possibly damaging Het
Csrnp2 A G 15: 100,489,440 F49S probably damaging Het
Ctbp1 A G 5: 33,250,904 L228P possibly damaging Het
Ctdp1 A T 18: 80,449,401 D626E possibly damaging Het
Cyp1a2 T C 9: 57,682,286 T82A possibly damaging Het
Dnah3 T G 7: 119,967,959 D2348A probably damaging Het
Dnah3 T A 7: 119,967,570 T2478S possibly damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 A G 6: 73,092,192 I2504T probably damaging Het
Dnase1l2 A C 17: 24,441,651 W138G probably damaging Het
Dopey2 T A 16: 93,766,173 I855N probably damaging Het
Dsc3 T A 18: 19,965,846 N759Y possibly damaging Het
Dtx2 C T 5: 136,032,293 R510* probably null Het
Fat4 G A 3: 38,996,090 E4034K probably damaging Het
Fat4 G T 3: 38,887,115 M52I probably benign Het
Fezf2 T C 14: 12,344,350 K279R probably damaging Het
Fsip2 G T 2: 82,976,517 W1060L possibly damaging Het
G6pc T A 11: 101,367,942 I49N probably damaging Het
Gars A G 6: 55,077,772 E688G probably null Het
Gdf11 T C 10: 128,885,242 N361S probably benign Het
Gli3 A C 13: 15,726,380 M1451L probably benign Het
Heatr3 T C 8: 88,150,317 I329T probably benign Het
Herc3 T G 6: 58,884,975 probably null Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Igsf3 A T 3: 101,431,296 I309F probably benign Het
Kif21b C T 1: 136,152,264 R513W probably damaging Het
Kif7 G T 7: 79,699,241 H1195Q probably benign Het
Lpcat4 T C 2: 112,242,542 V182A possibly damaging Het
Map3k21 T A 8: 125,927,555 I371N probably benign Het
Mns1 G A 9: 72,448,759 probably null Het
Myo3a A G 2: 22,578,128 T465A possibly damaging Het
Nlrc4 A T 17: 74,426,943 S992T probably benign Het
Notch4 G A 17: 34,587,588 G1833E possibly damaging Het
Olfr160 A T 9: 37,711,697 I194K possibly damaging Het
Olfr467 A T 7: 107,814,700 I39L probably benign Het
Olfr600 T A 7: 103,346,109 Y273F possibly damaging Het
Olfr666 T C 7: 104,892,903 T242A probably damaging Het
Olfr998 G A 2: 85,590,641 V34I probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pik3cd T A 4: 149,663,203 T28S probably damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Ppm1f T C 16: 16,923,666 S335P probably damaging Het
Prr16 C T 18: 51,303,277 P276L probably damaging Het
Rilp A G 11: 75,510,933 probably null Het
Rspry1 A G 8: 94,632,054 probably null Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Smyd5 T C 6: 85,438,136 I42T possibly damaging Het
Stk17b T C 1: 53,761,082 N246D probably damaging Het
Suco T C 1: 161,818,811 probably null Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tecpr1 C T 5: 144,204,697 V785M possibly damaging Het
Telo2 C T 17: 25,101,668 V756I probably benign Het
Tgm1 C T 14: 55,705,577 R602H probably benign Het
Timeless A G 10: 128,244,187 T402A probably damaging Het
Tnfaip2 T A 12: 111,449,891 probably null Het
Trim5 A G 7: 104,265,621 S414P probably damaging Het
Txnip A G 3: 96,559,750 T247A possibly damaging Het
Vmn1r174 A T 7: 23,754,625 T239S probably damaging Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Zranb3 A T 1: 127,959,743 N982K probably benign Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0172:Cep350 UTSW 1 155953447 missense probably benign 0.00
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0645:Cep350 UTSW 1 155940712 splice site probably null
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155931518 missense probably damaging 1.00
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155953358 missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1740:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4035:Cep350 UTSW 1 155959795 missense probably benign 0.06
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R4969:Cep350 UTSW 1 155860279 missense probably damaging 0.99
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5182:Cep350 UTSW 1 155858108 missense probably damaging 1.00
R5445:Cep350 UTSW 1 155894723 missense probably benign 0.01
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155894673 missense probably damaging 1.00
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
R7336:Cep350 UTSW 1 155862276 missense probably benign 0.17
R7361:Cep350 UTSW 1 155901491 missense probably damaging 1.00
R7390:Cep350 UTSW 1 155866087 missense possibly damaging 0.94
R7402:Cep350 UTSW 1 155928215 missense probably benign 0.00
R7428:Cep350 UTSW 1 155894619 missense probably benign 0.00
R7440:Cep350 UTSW 1 155940772 missense probably damaging 0.98
R7520:Cep350 UTSW 1 155915629 missense probably benign 0.05
R7529:Cep350 UTSW 1 155861923 missense probably benign 0.08
R7635:Cep350 UTSW 1 155879021 nonsense probably null
R7806:Cep350 UTSW 1 155862063 missense probably benign 0.00
RF020:Cep350 UTSW 1 155915478 missense probably benign 0.34
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GAAGCCGTCTAGAGACCAATGG -3'
(R):5'- TTGCCAGTTGAAATTCGTGG -3'

Sequencing Primer
(F):5'- AGAGAAGGCTTCCCTCTGTC -3'
(R):5'- CCAGTTGAAATTCGTGGGATTC -3'
Posted On2014-08-25