Incidental Mutation 'R1988:Suco'
ID222777
Institutional Source Beutler Lab
Gene Symbol Suco
Ensembl Gene ENSMUSG00000040297
Gene NameSUN domain containing ossification factor
SynonymsAI848100, Opt, osteopotentia
MMRRC Submission 040000-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.529) question?
Stock #R1988 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location161816114-161876682 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 161818811 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048377] [ENSMUST00000048377]
Predicted Effect probably null
Transcript: ENSMUST00000048377
SMART Domains Protein: ENSMUSP00000044815
Gene: ENSMUSG00000040297

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 32 41 N/A INTRINSIC
low complexity region 117 145 N/A INTRINSIC
low complexity region 208 224 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
Pfam:Sad1_UNC 325 455 9e-43 PFAM
low complexity region 665 683 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
coiled coil region 933 1009 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1105 1119 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000048377
SMART Domains Protein: ENSMUSP00000044815
Gene: ENSMUSG00000040297

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 32 41 N/A INTRINSIC
low complexity region 117 145 N/A INTRINSIC
low complexity region 208 224 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
Pfam:Sad1_UNC 325 455 9e-43 PFAM
low complexity region 665 683 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
coiled coil region 933 1009 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1105 1119 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192573
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (79/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a mutation in this gene display background strain-dependent neonatal and postnatal lethality, and impaired osteoblast differentiation resulting in impaired bone formation, brittle bones, and impaired fracture repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,896 D216V possibly damaging Het
2610021A01Rik C T 7: 41,626,657 R595* probably null Het
Adgrl3 A G 5: 81,688,567 D724G probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Akt1 T C 12: 112,655,151 I404V probably benign Het
Anxa13 T A 15: 58,341,948 noncoding transcript Het
Atoh1 T C 6: 64,729,633 V104A probably benign Het
Brwd1 T C 16: 96,021,237 D1256G probably damaging Het
C9 ATTTT ATTT 15: 6,483,138 probably null Het
Cd164 A G 10: 41,523,181 T89A probably benign Het
Cep350 G C 1: 155,933,104 N575K possibly damaging Het
Chrm5 A G 2: 112,480,252 V173A probably damaging Het
Cnot1 A G 8: 95,741,944 V1417A possibly damaging Het
Cntnap3 T C 13: 64,758,390 T801A probably damaging Het
Cntnap5b A C 1: 100,072,140 K208Q possibly damaging Het
Crx A T 7: 15,869,347 V107D possibly damaging Het
Csrnp2 A G 15: 100,489,440 F49S probably damaging Het
Ctbp1 A G 5: 33,250,904 L228P possibly damaging Het
Ctdp1 A T 18: 80,449,401 D626E possibly damaging Het
Cyp1a2 T C 9: 57,682,286 T82A possibly damaging Het
Dnah3 T A 7: 119,967,570 T2478S possibly damaging Het
Dnah3 T G 7: 119,967,959 D2348A probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 A G 6: 73,092,192 I2504T probably damaging Het
Dnase1l2 A C 17: 24,441,651 W138G probably damaging Het
Dopey2 T A 16: 93,766,173 I855N probably damaging Het
Dsc3 T A 18: 19,965,846 N759Y possibly damaging Het
Dtx2 C T 5: 136,032,293 R510* probably null Het
Fat4 G T 3: 38,887,115 M52I probably benign Het
Fat4 G A 3: 38,996,090 E4034K probably damaging Het
Fezf2 T C 14: 12,344,350 K279R probably damaging Het
Fsip2 G T 2: 82,976,517 W1060L possibly damaging Het
G6pc T A 11: 101,367,942 I49N probably damaging Het
Gars A G 6: 55,077,772 E688G probably null Het
Gdf11 T C 10: 128,885,242 N361S probably benign Het
Gli3 A C 13: 15,726,380 M1451L probably benign Het
Heatr3 T C 8: 88,150,317 I329T probably benign Het
Herc3 T G 6: 58,884,975 probably null Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Igsf3 A T 3: 101,431,296 I309F probably benign Het
Kif21b C T 1: 136,152,264 R513W probably damaging Het
Kif7 G T 7: 79,699,241 H1195Q probably benign Het
Lpcat4 T C 2: 112,242,542 V182A possibly damaging Het
Map3k21 T A 8: 125,927,555 I371N probably benign Het
Mns1 G A 9: 72,448,759 probably null Het
Myo3a A G 2: 22,578,128 T465A possibly damaging Het
Nlrc4 A T 17: 74,426,943 S992T probably benign Het
Notch4 G A 17: 34,587,588 G1833E possibly damaging Het
Olfr160 A T 9: 37,711,697 I194K possibly damaging Het
Olfr467 A T 7: 107,814,700 I39L probably benign Het
Olfr600 T A 7: 103,346,109 Y273F possibly damaging Het
Olfr666 T C 7: 104,892,903 T242A probably damaging Het
Olfr998 G A 2: 85,590,641 V34I probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pik3cd T A 4: 149,663,203 T28S probably damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Ppm1f T C 16: 16,923,666 S335P probably damaging Het
Prr16 C T 18: 51,303,277 P276L probably damaging Het
Rilp A G 11: 75,510,933 probably null Het
Rspry1 A G 8: 94,632,054 probably null Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Smyd5 T C 6: 85,438,136 I42T possibly damaging Het
Stk17b T C 1: 53,761,082 N246D probably damaging Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tecpr1 C T 5: 144,204,697 V785M possibly damaging Het
Telo2 C T 17: 25,101,668 V756I probably benign Het
Tgm1 C T 14: 55,705,577 R602H probably benign Het
Timeless A G 10: 128,244,187 T402A probably damaging Het
Tnfaip2 T A 12: 111,449,891 probably null Het
Trim5 A G 7: 104,265,621 S414P probably damaging Het
Txnip A G 3: 96,559,750 T247A possibly damaging Het
Vmn1r174 A T 7: 23,754,625 T239S probably damaging Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Zranb3 A T 1: 127,959,743 N982K probably benign Het
Other mutations in Suco
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Suco APN 1 161834120 missense probably damaging 1.00
IGL01688:Suco APN 1 161863911 splice site probably null
IGL01794:Suco APN 1 161827725 missense probably benign 0.01
IGL01891:Suco APN 1 161838802 missense probably damaging 1.00
IGL02028:Suco APN 1 161856859 missense possibly damaging 0.95
IGL02102:Suco APN 1 161827705 missense probably damaging 1.00
IGL02351:Suco APN 1 161818626 missense probably benign 0.35
IGL02358:Suco APN 1 161818626 missense probably benign 0.35
IGL02392:Suco APN 1 161834567 missense probably benign 0.11
IGL02638:Suco APN 1 161827687 missense probably damaging 1.00
IGL02650:Suco APN 1 161848753 splice site probably benign
IGL03106:Suco APN 1 161834480 missense possibly damaging 0.91
IGL03189:Suco APN 1 161857337 unclassified probably benign
IGL03328:Suco APN 1 161820421 missense probably damaging 0.99
girth UTSW 1 161828240 missense possibly damaging 0.86
pleasingly UTSW 1 161834408 missense possibly damaging 0.65
3-1:Suco UTSW 1 161822031 intron probably benign
H8562:Suco UTSW 1 161852851 missense probably damaging 1.00
H8786:Suco UTSW 1 161852851 missense probably damaging 1.00
R0023:Suco UTSW 1 161845585 splice site probably null
R0023:Suco UTSW 1 161845585 splice site probably null
R0179:Suco UTSW 1 161876305 splice site probably benign
R0299:Suco UTSW 1 161853810 missense probably benign
R0418:Suco UTSW 1 161834850 missense probably benign 0.11
R0481:Suco UTSW 1 161862313 unclassified probably benign
R0610:Suco UTSW 1 161859503 missense probably benign
R0610:Suco UTSW 1 161864032 splice site probably benign
R0634:Suco UTSW 1 161838804 missense possibly damaging 0.77
R0645:Suco UTSW 1 161834114 missense probably damaging 1.00
R1276:Suco UTSW 1 161857456 missense probably benign 0.10
R1720:Suco UTSW 1 161834054 missense probably damaging 1.00
R1739:Suco UTSW 1 161827655 critical splice donor site probably null
R1763:Suco UTSW 1 161834949 missense possibly damaging 0.80
R1835:Suco UTSW 1 161859500 nonsense probably null
R2939:Suco UTSW 1 161848651 missense probably damaging 1.00
R3773:Suco UTSW 1 161843996 splice site probably null
R3882:Suco UTSW 1 161834744 missense probably benign 0.33
R4193:Suco UTSW 1 161863959 missense probably benign 0.32
R4367:Suco UTSW 1 161847230 missense probably damaging 1.00
R4397:Suco UTSW 1 161844852 missense probably damaging 1.00
R4846:Suco UTSW 1 161834408 missense possibly damaging 0.65
R4851:Suco UTSW 1 161834192 missense probably damaging 1.00
R5224:Suco UTSW 1 161834705 missense probably benign 0.06
R5329:Suco UTSW 1 161833430 missense probably damaging 0.99
R6133:Suco UTSW 1 161835183 nonsense probably null
R6632:Suco UTSW 1 161828240 missense possibly damaging 0.86
R6643:Suco UTSW 1 161859432 missense possibly damaging 0.71
R7378:Suco UTSW 1 161862211 missense possibly damaging 0.76
R7405:Suco UTSW 1 161828214 missense possibly damaging 0.65
R7509:Suco UTSW 1 161845334 missense probably damaging 1.00
R7838:Suco UTSW 1 161829321 missense probably benign 0.07
R7867:Suco UTSW 1 161837796 missense possibly damaging 0.77
R7895:Suco UTSW 1 161845368 splice site probably null
R8440:Suco UTSW 1 161852338 missense probably damaging 1.00
R8453:Suco UTSW 1 161823017 intron probably benign
R8781:Suco UTSW 1 161818382 missense probably damaging 1.00
R8798:Suco UTSW 1 161820435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGAAGTTTCCGAGCTGCC -3'
(R):5'- TTTACAAAGGGGATGTCAGAGATAC -3'

Sequencing Primer
(F):5'- AAGTTTCCGAGCTGCCCTCAG -3'
(R):5'- GGGGATGTCAGAGATACTATCTATTC -3'
Posted On2014-08-25