Incidental Mutation 'R1988:Txnip'
ID222803
Institutional Source Beutler Lab
Gene Symbol Txnip
Ensembl Gene ENSMUSG00000038393
Gene Namethioredoxin interacting protein
SynonymsTHIF, VDUP1, mVDUP1, Hyplip1
MMRRC Submission 040000-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1988 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96557957-96561883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96559750 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 247 (T247A)
Ref Sequence ENSEMBL: ENSMUSP00000102710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049093] [ENSMUST00000074519]
Predicted Effect probably benign
Transcript: ENSMUST00000049093
AA Change: T246A

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041467
Gene: ENSMUSG00000038393
AA Change: T246A

DomainStartEndE-ValueType
Pfam:Arrestin_N 10 152 6.8e-26 PFAM
Arrestin_C 174 301 6.4e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000074519
AA Change: T247A

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102710
Gene: ENSMUSG00000038393
AA Change: T247A

DomainStartEndE-ValueType
Pfam:Arrestin_N 10 153 1.1e-25 PFAM
Arrestin_C 175 302 6.4e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196871
Meta Mutation Damage Score 0.1057 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a thioredoxin-binding protein that is a member of the alpha arrestin protein family. Thioredoxin is a thiol-oxidoreductase that is a major regulator of cellular redox signaling which protects cells from oxidative stress. This protein inhibits the antioxidative function of thioredoxin resulting in the accumulation of reactive oxygen species and cellular stress. This protein also functions as a regulator of cellular metabolism and of endoplasmic reticulum (ER) stress. This protein may also function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display impaired natural killer cell development and activity, hyperplasia of lymphoid tissue in the ileum, and increased T cell proliferation. Lipid metabolism and blood clotting were also affected by another null mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,896 D216V possibly damaging Het
2610021A01Rik C T 7: 41,626,657 R595* probably null Het
Adgrl3 A G 5: 81,688,567 D724G probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Akt1 T C 12: 112,655,151 I404V probably benign Het
Anxa13 T A 15: 58,341,948 noncoding transcript Het
Atoh1 T C 6: 64,729,633 V104A probably benign Het
Brwd1 T C 16: 96,021,237 D1256G probably damaging Het
C9 ATTTT ATTT 15: 6,483,138 probably null Het
Cd164 A G 10: 41,523,181 T89A probably benign Het
Cep350 G C 1: 155,933,104 N575K possibly damaging Het
Chrm5 A G 2: 112,480,252 V173A probably damaging Het
Cnot1 A G 8: 95,741,944 V1417A possibly damaging Het
Cntnap3 T C 13: 64,758,390 T801A probably damaging Het
Cntnap5b A C 1: 100,072,140 K208Q possibly damaging Het
Crx A T 7: 15,869,347 V107D possibly damaging Het
Csrnp2 A G 15: 100,489,440 F49S probably damaging Het
Ctbp1 A G 5: 33,250,904 L228P possibly damaging Het
Ctdp1 A T 18: 80,449,401 D626E possibly damaging Het
Cyp1a2 T C 9: 57,682,286 T82A possibly damaging Het
Dnah3 T A 7: 119,967,570 T2478S possibly damaging Het
Dnah3 T G 7: 119,967,959 D2348A probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 A G 6: 73,092,192 I2504T probably damaging Het
Dnase1l2 A C 17: 24,441,651 W138G probably damaging Het
Dopey2 T A 16: 93,766,173 I855N probably damaging Het
Dsc3 T A 18: 19,965,846 N759Y possibly damaging Het
Dtx2 C T 5: 136,032,293 R510* probably null Het
Fat4 G T 3: 38,887,115 M52I probably benign Het
Fat4 G A 3: 38,996,090 E4034K probably damaging Het
Fezf2 T C 14: 12,344,350 K279R probably damaging Het
Fsip2 G T 2: 82,976,517 W1060L possibly damaging Het
G6pc T A 11: 101,367,942 I49N probably damaging Het
Gars A G 6: 55,077,772 E688G probably null Het
Gdf11 T C 10: 128,885,242 N361S probably benign Het
Gli3 A C 13: 15,726,380 M1451L probably benign Het
Heatr3 T C 8: 88,150,317 I329T probably benign Het
Herc3 T G 6: 58,884,975 probably null Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Igsf3 A T 3: 101,431,296 I309F probably benign Het
Kif21b C T 1: 136,152,264 R513W probably damaging Het
Kif7 G T 7: 79,699,241 H1195Q probably benign Het
Lpcat4 T C 2: 112,242,542 V182A possibly damaging Het
Map3k21 T A 8: 125,927,555 I371N probably benign Het
Mns1 G A 9: 72,448,759 probably null Het
Myo3a A G 2: 22,578,128 T465A possibly damaging Het
Nlrc4 A T 17: 74,426,943 S992T probably benign Het
Notch4 G A 17: 34,587,588 G1833E possibly damaging Het
Olfr160 A T 9: 37,711,697 I194K possibly damaging Het
Olfr467 A T 7: 107,814,700 I39L probably benign Het
Olfr600 T A 7: 103,346,109 Y273F possibly damaging Het
Olfr666 T C 7: 104,892,903 T242A probably damaging Het
Olfr998 G A 2: 85,590,641 V34I probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pik3cd T A 4: 149,663,203 T28S probably damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Ppm1f T C 16: 16,923,666 S335P probably damaging Het
Prr16 C T 18: 51,303,277 P276L probably damaging Het
Rilp A G 11: 75,510,933 probably null Het
Rspry1 A G 8: 94,632,054 probably null Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Smyd5 T C 6: 85,438,136 I42T possibly damaging Het
Stk17b T C 1: 53,761,082 N246D probably damaging Het
Suco T C 1: 161,818,811 probably null Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tecpr1 C T 5: 144,204,697 V785M possibly damaging Het
Telo2 C T 17: 25,101,668 V756I probably benign Het
Tgm1 C T 14: 55,705,577 R602H probably benign Het
Timeless A G 10: 128,244,187 T402A probably damaging Het
Tnfaip2 T A 12: 111,449,891 probably null Het
Trim5 A G 7: 104,265,621 S414P probably damaging Het
Vmn1r174 A T 7: 23,754,625 T239S probably damaging Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Zranb3 A T 1: 127,959,743 N982K probably benign Het
Other mutations in Txnip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02297:Txnip APN 3 96558357 missense probably damaging 1.00
IGL02953:Txnip APN 3 96558366 missense probably damaging 0.97
IGL03066:Txnip APN 3 96559618 missense probably damaging 0.97
P0029:Txnip UTSW 3 96560363 splice site probably null
R0336:Txnip UTSW 3 96559979 missense probably benign 0.00
R1604:Txnip UTSW 3 96558961 missense probably benign 0.18
R4603:Txnip UTSW 3 96558288 missense probably benign
R4659:Txnip UTSW 3 96559427 missense probably damaging 1.00
R4845:Txnip UTSW 3 96559600 missense probably benign 0.36
R6787:Txnip UTSW 3 96560307 missense probably damaging 1.00
R6992:Txnip UTSW 3 96559123 missense possibly damaging 0.47
R7241:Txnip UTSW 3 96559675 missense probably damaging 1.00
R7488:Txnip UTSW 3 96560223 missense probably benign 0.05
R7663:Txnip UTSW 3 96559837 missense possibly damaging 0.82
R8151:Txnip UTSW 3 96559613 missense possibly damaging 0.94
R8669:Txnip UTSW 3 96558936 missense probably damaging 1.00
X0050:Txnip UTSW 3 96559778 missense probably damaging 1.00
X0057:Txnip UTSW 3 96558965 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACTTGCATGGCTATTCATACTTCC -3'
(R):5'- TGACTTTCTTGGAGCCAGGG -3'

Sequencing Primer
(F):5'- AACACGTGTTCCCGAATC -3'
(R):5'- AGGGACACTGACGTAGATCTAG -3'
Posted On2014-08-25