Incidental Mutation 'R1988:Pik3cd'
ID222811
Institutional Source Beutler Lab
Gene Symbol Pik3cd
Ensembl Gene ENSMUSG00000039936
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta
Synonyms2410099E07Rik, p110delta, 2610208K16Rik
MMRRC Submission 040000-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R1988 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location149649168-149702571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 149663203 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 28 (T28S)
Ref Sequence ENSEMBL: ENSMUSP00000119858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038859] [ENSMUST00000105688] [ENSMUST00000105689] [ENSMUST00000105690] [ENSMUST00000118704] [ENSMUST00000122059] [ENSMUST00000127273] [ENSMUST00000131224] [ENSMUST00000134534] [ENSMUST00000146612] [ENSMUST00000156309] [ENSMUST00000177654]
Predicted Effect probably damaging
Transcript: ENSMUST00000038859
AA Change: T28S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036434
Gene: ENSMUSG00000039936
AA Change: T28S

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 685 8.56e-87 SMART
PI3Kc 776 1042 5.65e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105688
AA Change: T28S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101313
Gene: ENSMUSG00000039936
AA Change: T28S

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 685 8.56e-87 SMART
PI3Kc 775 1041 5.65e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105689
AA Change: T28S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101314
Gene: ENSMUSG00000039936
AA Change: T28S

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 684 1.35e-84 SMART
PI3Kc 774 1040 5.65e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105690
AA Change: T28S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101315
Gene: ENSMUSG00000039936
AA Change: T28S

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118704
AA Change: T28S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112863
Gene: ENSMUSG00000039936
AA Change: T28S

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 687 1.8e-80 SMART
PI3Kc 777 1043 5.65e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122059
AA Change: T28S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113844
Gene: ENSMUSG00000039936
AA Change: T28S

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 408 6.47e-23 SMART
PI3Ka 492 681 8.56e-87 SMART
PI3Kc 771 1037 5.65e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127273
AA Change: T28S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119858
Gene: ENSMUSG00000039936
AA Change: T28S

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
Blast:PI3K_rbd 126 171 1e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000131224
AA Change: T28S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115542
Gene: ENSMUSG00000039936
AA Change: T28S

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134534
AA Change: T28S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118988
Gene: ENSMUSG00000039936
AA Change: T28S

DomainStartEndE-ValueType
Pfam:PI3K_p85B 31 62 1.9e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146612
AA Change: T28S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121843
Gene: ENSMUSG00000039936
AA Change: T28S

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000156309
AA Change: T28S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000177654
AA Change: T28S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136045
Gene: ENSMUSG00000039936
AA Change: T28S

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Meta Mutation Damage Score 0.4530 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I PI3K found primarily in leukocytes. Like other class I PI3Ks (p110-alpha p110-beta, and p110-gamma), the encoded protein binds p85 adapter proteins and GTP-bound RAS. However, unlike the other class I PI3Ks, this protein phosphorylates itself, not p85 protein.[provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired B and T cell antigen receptor signaling, reduced or ablated immune responses and decreased immunoglobulin levels. Mutants also develop inflammatory bowel disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,896 D216V possibly damaging Het
2610021A01Rik C T 7: 41,626,657 R595* probably null Het
Adgrl3 A G 5: 81,688,567 D724G probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Akt1 T C 12: 112,655,151 I404V probably benign Het
Anxa13 T A 15: 58,341,948 noncoding transcript Het
Atoh1 T C 6: 64,729,633 V104A probably benign Het
Brwd1 T C 16: 96,021,237 D1256G probably damaging Het
C9 ATTTT ATTT 15: 6,483,138 probably null Het
Cd164 A G 10: 41,523,181 T89A probably benign Het
Cep350 G C 1: 155,933,104 N575K possibly damaging Het
Chrm5 A G 2: 112,480,252 V173A probably damaging Het
Cnot1 A G 8: 95,741,944 V1417A possibly damaging Het
Cntnap3 T C 13: 64,758,390 T801A probably damaging Het
Cntnap5b A C 1: 100,072,140 K208Q possibly damaging Het
Crx A T 7: 15,869,347 V107D possibly damaging Het
Csrnp2 A G 15: 100,489,440 F49S probably damaging Het
Ctbp1 A G 5: 33,250,904 L228P possibly damaging Het
Ctdp1 A T 18: 80,449,401 D626E possibly damaging Het
Cyp1a2 T C 9: 57,682,286 T82A possibly damaging Het
Dnah3 T A 7: 119,967,570 T2478S possibly damaging Het
Dnah3 T G 7: 119,967,959 D2348A probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 A G 6: 73,092,192 I2504T probably damaging Het
Dnase1l2 A C 17: 24,441,651 W138G probably damaging Het
Dopey2 T A 16: 93,766,173 I855N probably damaging Het
Dsc3 T A 18: 19,965,846 N759Y possibly damaging Het
Dtx2 C T 5: 136,032,293 R510* probably null Het
Fat4 G T 3: 38,887,115 M52I probably benign Het
Fat4 G A 3: 38,996,090 E4034K probably damaging Het
Fezf2 T C 14: 12,344,350 K279R probably damaging Het
Fsip2 G T 2: 82,976,517 W1060L possibly damaging Het
G6pc T A 11: 101,367,942 I49N probably damaging Het
Gars A G 6: 55,077,772 E688G probably null Het
Gdf11 T C 10: 128,885,242 N361S probably benign Het
Gli3 A C 13: 15,726,380 M1451L probably benign Het
Heatr3 T C 8: 88,150,317 I329T probably benign Het
Herc3 T G 6: 58,884,975 probably null Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Igsf3 A T 3: 101,431,296 I309F probably benign Het
Kif21b C T 1: 136,152,264 R513W probably damaging Het
Kif7 G T 7: 79,699,241 H1195Q probably benign Het
Lpcat4 T C 2: 112,242,542 V182A possibly damaging Het
Map3k21 T A 8: 125,927,555 I371N probably benign Het
Mns1 G A 9: 72,448,759 probably null Het
Myo3a A G 2: 22,578,128 T465A possibly damaging Het
Nlrc4 A T 17: 74,426,943 S992T probably benign Het
Notch4 G A 17: 34,587,588 G1833E possibly damaging Het
Olfr160 A T 9: 37,711,697 I194K possibly damaging Het
Olfr467 A T 7: 107,814,700 I39L probably benign Het
Olfr600 T A 7: 103,346,109 Y273F possibly damaging Het
Olfr666 T C 7: 104,892,903 T242A probably damaging Het
Olfr998 G A 2: 85,590,641 V34I probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Ppm1f T C 16: 16,923,666 S335P probably damaging Het
Prr16 C T 18: 51,303,277 P276L probably damaging Het
Rilp A G 11: 75,510,933 probably null Het
Rspry1 A G 8: 94,632,054 probably null Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Smyd5 T C 6: 85,438,136 I42T possibly damaging Het
Stk17b T C 1: 53,761,082 N246D probably damaging Het
Suco T C 1: 161,818,811 probably null Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tecpr1 C T 5: 144,204,697 V785M possibly damaging Het
Telo2 C T 17: 25,101,668 V756I probably benign Het
Tgm1 C T 14: 55,705,577 R602H probably benign Het
Timeless A G 10: 128,244,187 T402A probably damaging Het
Tnfaip2 T A 12: 111,449,891 probably null Het
Trim5 A G 7: 104,265,621 S414P probably damaging Het
Txnip A G 3: 96,559,750 T247A possibly damaging Het
Vmn1r174 A T 7: 23,754,625 T239S probably damaging Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Zranb3 A T 1: 127,959,743 N982K probably benign Het
Other mutations in Pik3cd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Pik3cd APN 4 149657460 missense probably damaging 1.00
IGL01536:Pik3cd APN 4 149652666 missense probably damaging 1.00
IGL01636:Pik3cd APN 4 149654315 missense possibly damaging 0.82
IGL02794:Pik3cd APN 4 149654571 missense probably benign
grand_tetons UTSW 4 149652699 missense probably damaging 1.00
stinger UTSW 4 149657319 missense probably damaging 1.00
F5770:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
R0003:Pik3cd UTSW 4 149656379 critical splice donor site probably null
R0309:Pik3cd UTSW 4 149663220 missense probably damaging 1.00
R1246:Pik3cd UTSW 4 149659800 missense probably damaging 1.00
R1259:Pik3cd UTSW 4 149650648 nonsense probably null
R1533:Pik3cd UTSW 4 149655196 missense probably damaging 1.00
R1756:Pik3cd UTSW 4 149658750 missense probably benign 0.02
R1796:Pik3cd UTSW 4 149654119 missense possibly damaging 0.83
R1887:Pik3cd UTSW 4 149652634 missense probably damaging 1.00
R2089:Pik3cd UTSW 4 149652699 missense probably damaging 1.00
R2091:Pik3cd UTSW 4 149652699 missense probably damaging 1.00
R4997:Pik3cd UTSW 4 149658984 missense probably damaging 1.00
R5391:Pik3cd UTSW 4 149659131 missense probably damaging 0.98
R5603:Pik3cd UTSW 4 149658855 missense probably benign
R6282:Pik3cd UTSW 4 149659743 missense probably benign 0.00
R6453:Pik3cd UTSW 4 149652302 missense probably damaging 1.00
R7286:Pik3cd UTSW 4 149659714 missense probably benign 0.08
R7423:Pik3cd UTSW 4 149651763 critical splice donor site probably null
R7508:Pik3cd UTSW 4 149654583 missense possibly damaging 0.78
R7665:Pik3cd UTSW 4 149654050 missense possibly damaging 0.70
R7897:Pik3cd UTSW 4 149657269 missense probably benign 0.06
R7980:Pik3cd UTSW 4 149657269 missense probably benign 0.06
R8039:Pik3cd UTSW 4 149659866 missense possibly damaging 0.91
V7580:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7581:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7582:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7583:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
X0023:Pik3cd UTSW 4 149660034 missense probably benign 0.04
Z1176:Pik3cd UTSW 4 149654847 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCTGAGAAATGGCAGCCAAG -3'
(R):5'- GCCTCATGTGTAGCAAGCTTTG -3'

Sequencing Primer
(F):5'- CATCAAGGTGTGAGAAGC -3'
(R):5'- TCCTGTGGCCCAGATCTG -3'
Posted On2014-08-25