Mutagenetix > Incidental Mutation

Incidental Mutation 'R2015:Pik3c2a'

222818

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2a

Ensembl Gene

ENSMUSG00000030660

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha

Synonyms

PI3KC2

MMRRC Submission

040024-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2015 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116337265-116443449 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 116350931 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000206219]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000170430

SMART Domains

Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
low complexity region	361	372	N/A	INTRINSIC
PI3K_rbd	410	513	3.08e-38	SMART
PI3K_C2	674	783	2.71e-34	SMART
PI3Ka	860	1047	3.62e-85	SMART
PI3Kc	1134	1396	3.1e-125	SMART
PX	1422	1534	5.68e-30	SMART
C2	1573	1677	3.93e-14	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000206219

Predicted Effect

probably benign
Transcript: ENSMUST00000206385

Meta Mutation Damage Score

0.9500

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	C	A	11: 101,987,218	H35Q	probably damaging	Het
1700015F17Rik	T	A	5: 5,455,964	I106L	probably benign	Het
Abca9	A	T	11: 110,131,846	M1022K	probably benign	Het
Abhd4	T	A	14: 54,262,832	H74Q	probably damaging	Het
Actg1	A	G	11: 120,346,810	S49P	possibly damaging	Het
Adcy8	C	T	15: 64,767,878	G678S	probably benign	Het
Aire	T	C	10: 78,042,958	D85G	probably damaging	Het
Akr1c18	T	A	13: 4,145,309	D50V	probably damaging	Het
Ankrd13a	C	A	5: 114,792,109	A185E	probably damaging	Het
Apc	A	G	18: 34,315,591	I1813V	probably damaging	Het
Armc8	A	T	9: 99,483,105	C661*	probably null	Het
Bbs10	C	T	10: 111,300,855	Q610*	probably null	Het
Blm	T	C	7: 80,502,399	E600G	probably damaging	Het
Bpifb9a	T	C	2: 154,268,200		probably null	Het
Cdk14	T	C	5: 5,380,082	K15R	probably benign	Het
Cdr1	A	G	X: 61,184,814	F249L	probably benign	Het
Cep250	A	C	2: 155,981,453	H1009P	probably damaging	Het
Clasp2	A	G	9: 113,911,500	T495A	possibly damaging	Het
Col19a1	C	G	1: 24,559,753	G53A	unknown	Het
Cpne1	G	A	2: 156,078,388	R166C	probably damaging	Het
Dtx3l	G	A	16: 35,936,427	H129Y	probably benign	Het
Ercc3	A	G	18: 32,248,429	T433A	probably benign	Het
Gm9936	T	A	5: 114,857,421		probably benign	Het
Grina	T	C	15: 76,248,534	V167A	probably damaging	Het
Hcfc2	A	G	10: 82,738,980	N618D	probably benign	Het
Herpud1	T	C	8: 94,392,206	V196A	probably benign	Het
Hist3h2a	T	A	11: 58,954,928	L64Q	probably damaging	Het
Hlcs	A	G	16: 94,262,740	V487A	probably benign	Het
Hspa9	A	T	18: 34,946,648	Y243N	probably damaging	Het
Igll1	A	G	16: 16,863,775	S39P	probably benign	Het
Kdm5a	T	C	6: 120,431,990	S1545P	probably benign	Het
Klra8	C	A	6: 130,115,573	C255F	probably damaging	Het
Krtap4-6	A	T	11: 99,665,572	C110S	unknown	Het
Lef1	T	A	3: 131,111,587	I39N	probably damaging	Het
Lnpep	G	A	17: 17,579,063	T110I	probably damaging	Het
Lrp1	T	A	10: 127,540,694	T4282S	probably benign	Het
Lrp6	A	G	6: 134,480,374		probably null	Het
Ly6g5b	A	C	17: 35,114,678	S53A	possibly damaging	Het
M6pr	T	G	6: 122,313,373	N98K	probably damaging	Het
Mal2	T	C	15: 54,600,740	*176Q	probably null	Het
Mansc1	T	C	6: 134,610,311	D301G	possibly damaging	Het
March1	C	A	8: 66,121,821	N11K	probably damaging	Het
Mast3	T	A	8: 70,787,363	I338F	probably benign	Het
Mcm3	A	G	1: 20,803,580	L772P	probably damaging	Het
Mib2	C	T	4: 155,657,880	G176D	probably damaging	Het
Mier2	A	T	10: 79,541,202		probably null	Het
Mogs	C	T	6: 83,117,650	R483*	probably null	Het
Msl2	G	T	9: 101,075,251		probably benign	Het
Naa16	A	T	14: 79,345,059	M530K	probably damaging	Het
Nde1	A	T	16: 14,169,457		probably benign	Het
Ndufb10	T	C	17: 24,722,529		probably null	Het
Nhsl1	A	T	10: 18,511,592	R205W	probably damaging	Het
Npffr2	T	A	5: 89,582,892	I227N	probably damaging	Het
Nup210l	T	A	3: 90,185,432	L1231Q	probably damaging	Het
Olfr1355	T	C	10: 78,879,388	I72T	possibly damaging	Het
Olfr453	A	G	6: 42,744,850	E271G	probably damaging	Het
Pclo	C	A	5: 14,521,501	P300Q	probably damaging	Het
Plekha5	T	A	6: 140,534,564		probably null	Het
Pls1	A	G	9: 95,761,365	V527A	possibly damaging	Het
Ppfia2	T	C	10: 106,474,677	M15T	probably benign	Het
Prkd2	T	A	7: 16,847,677	C152*	probably null	Het
Ptprq	T	G	10: 107,667,422	K792Q	probably damaging	Het
Rbbp8	T	C	18: 11,720,624	M296T	probably benign	Het
Rfc3	T	C	5: 151,647,538		probably null	Het
Rnf17	A	G	14: 56,486,969	N1090S	probably benign	Het
Sash1	A	T	10: 8,729,413	V1071D	probably benign	Het
Sdsl	G	A	5: 120,463,153	T18M	probably damaging	Het
Sepsecs	T	A	5: 52,647,624	Q365L	probably benign	Het
Sgta	A	T	10: 81,051,296	V45E	probably damaging	Het
Slc25a46	A	T	18: 31,609,725	H29Q	probably benign	Het
Slc2a8	A	C	2: 32,981,380	V136G	probably benign	Het
Smg7	A	T	1: 152,860,508	N166K	probably damaging	Het
Spata21	C	T	4: 141,107,329	Q505*	probably null	Het
Strn4	T	C	7: 16,833,028	S458P	possibly damaging	Het
Tbc1d22a	C	T	15: 86,299,684	T248M	probably damaging	Het
Trabd	T	A	15: 89,084,726	M149K	possibly damaging	Het
Trpv3	A	T	11: 73,279,827	N178Y	probably damaging	Het
Try5	C	T	6: 41,314,651		probably null	Het
Tsg101	C	T	7: 46,908,904		probably null	Het
Ube3b	A	G	5: 114,411,149	E738G	probably damaging	Het
Unc13d	A	G	11: 116,068,755	S631P	probably damaging	Het
Unc5d	T	C	8: 28,758,979	T297A	probably damaging	Het
Usp18	A	T	6: 121,268,550	E1V	probably damaging	Het
Vapb	C	A	2: 173,771,598	P97T	probably benign	Het
Vmn1r33	T	A	6: 66,612,372	D66V	probably benign	Het
Vmn2r19	T	A	6: 123,315,995	M332K	probably benign	Het
Vmn2r71	T	A	7: 85,620,637	M452K	probably benign	Het
Vps13b	T	C	15: 35,607,142	S1074P	probably damaging	Het
Vwde	C	A	6: 13,208,338	G182C	possibly damaging	Het
Wdfy3	A	C	5: 101,860,486	S2778A	probably null	Het
Zbtb2	T	A	10: 4,369,757	I90F	possibly damaging	Het
Zfp518b	C	A	5: 38,672,002	V887F	probably benign	Het
Zfp790	A	G	7: 29,828,861	T324A	probably benign	Het
Zufsp	A	G	10: 33,929,824	V437A	possibly damaging	Het

Other mutations in Pik3c2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Pik3c2a	APN	7	116376283	missense	possibly damaging	0.50
IGL00732:Pik3c2a	APN	7	116364500	missense	possibly damaging	0.82
IGL01303:Pik3c2a	APN	7	116373803	missense	possibly damaging	0.94
IGL01443:Pik3c2a	APN	7	116418194	missense	probably benign	0.01
IGL01462:Pik3c2a	APN	7	116376250	missense	possibly damaging	0.94
IGL01641:Pik3c2a	APN	7	116350765	intron	probably benign
IGL01695:Pik3c2a	APN	7	116417518	missense	possibly damaging	0.82
IGL02095:Pik3c2a	APN	7	116346188	missense	probably damaging	1.00
IGL02137:Pik3c2a	APN	7	116350804	missense	probably benign	0.00
IGL02160:Pik3c2a	APN	7	116388064	missense	probably damaging	1.00
IGL02224:Pik3c2a	APN	7	116363340	splice site	probably benign
IGL02345:Pik3c2a	APN	7	116405891	missense	probably damaging	1.00
IGL02644:Pik3c2a	APN	7	116372814	missense	probably benign	0.00
IGL02756:Pik3c2a	APN	7	116364513	missense	probably benign	0.01
IGL03339:Pik3c2a	APN	7	116418021	missense	possibly damaging	0.57
IGL03412:Pik3c2a	APN	7	116417839	missense	probably benign	0.21
R0046:Pik3c2a	UTSW	7	116354072	missense	probably damaging	1.00
R0387:Pik3c2a	UTSW	7	116373744	missense	probably damaging	1.00
R0501:Pik3c2a	UTSW	7	116354055	missense	probably damaging	1.00
R0650:Pik3c2a	UTSW	7	116346247	splice site	probably benign
R0991:Pik3c2a	UTSW	7	116362045	critical splice donor site	probably null
R1074:Pik3c2a	UTSW	7	116350925	nonsense	probably null
R1485:Pik3c2a	UTSW	7	116417673	missense	possibly damaging	0.50
R1495:Pik3c2a	UTSW	7	116388065	missense	probably benign	0.01
R1510:Pik3c2a	UTSW	7	116388045	missense	probably benign	0.00
R1654:Pik3c2a	UTSW	7	116368848	missense	probably benign	0.02
R1711:Pik3c2a	UTSW	7	116417927	nonsense	probably null
R1733:Pik3c2a	UTSW	7	116418520	start codon destroyed	possibly damaging	0.96
R1751:Pik3c2a	UTSW	7	116346236	missense	probably damaging	0.98
R1812:Pik3c2a	UTSW	7	116417664	missense	probably damaging	0.98
R1817:Pik3c2a	UTSW	7	116376512	critical splice donor site	probably null
R1826:Pik3c2a	UTSW	7	116368117	missense	probably benign
R1875:Pik3c2a	UTSW	7	116417971	missense	probably benign	0.35
R1995:Pik3c2a	UTSW	7	116354006	missense	probably damaging	1.00
R2007:Pik3c2a	UTSW	7	116342237	missense	probably damaging	1.00
R2009:Pik3c2a	UTSW	7	116364503	missense	probably damaging	1.00
R2013:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2014:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2027:Pik3c2a	UTSW	7	116350822	missense	probably damaging	1.00
R2050:Pik3c2a	UTSW	7	116417451	critical splice donor site	probably null
R2068:Pik3c2a	UTSW	7	116372891	nonsense	probably null
R3814:Pik3c2a	UTSW	7	116348179	missense	probably damaging	1.00
R3848:Pik3c2a	UTSW	7	116364550	nonsense	probably null
R4386:Pik3c2a	UTSW	7	116354099	missense	probably damaging	1.00
R4668:Pik3c2a	UTSW	7	116358688	missense	probably benign	0.16
R4783:Pik3c2a	UTSW	7	116417825	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	116340156	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	116340156	missense	probably damaging	1.00
R5057:Pik3c2a	UTSW	7	116376283	missense	possibly damaging	0.50
R5080:Pik3c2a	UTSW	7	116348274	missense	probably damaging	1.00
R5083:Pik3c2a	UTSW	7	116342401	missense	probably damaging	1.00
R5144:Pik3c2a	UTSW	7	116350786	missense	probably benign	0.01
R5589:Pik3c2a	UTSW	7	116417658	missense	probably benign	0.02
R5646:Pik3c2a	UTSW	7	116405951	missense	probably damaging	1.00
R5829:Pik3c2a	UTSW	7	116372814	missense	probably benign	0.00
R5951:Pik3c2a	UTSW	7	116368184	missense	probably damaging	0.96
R5958:Pik3c2a	UTSW	7	116362564	missense	probably damaging	1.00
R6356:Pik3c2a	UTSW	7	116348205	missense	possibly damaging	0.46
R6551:Pik3c2a	UTSW	7	116417496	missense	probably damaging	0.97
R6641:Pik3c2a	UTSW	7	116340225	critical splice acceptor site	probably null
R6661:Pik3c2a	UTSW	7	116368758	missense	possibly damaging	0.77
R6789:Pik3c2a	UTSW	7	116362184	missense	probably damaging	1.00
R6874:Pik3c2a	UTSW	7	116394305	missense	probably damaging	1.00
R6985:Pik3c2a	UTSW	7	116417988	missense	probably damaging	0.98
R7106:Pik3c2a	UTSW	7	116418133	nonsense	probably null
R7153:Pik3c2a	UTSW	7	116342252	missense	probably damaging	1.00
R7176:Pik3c2a	UTSW	7	116388096	missense	possibly damaging	0.47
R7265:Pik3c2a	UTSW	7	116388086	missense	probably damaging	1.00
R7303:Pik3c2a	UTSW	7	116405943	missense	probably benign	0.00
R7308:Pik3c2a	UTSW	7	116373839	missense	probably damaging	1.00
R7375:Pik3c2a	UTSW	7	116376386	missense	probably damaging	1.00
R7406:Pik3c2a	UTSW	7	116354007	missense	probably damaging	1.00
R7426:Pik3c2a	UTSW	7	116372854	missense	probably damaging	1.00
R7528:Pik3c2a	UTSW	7	116394239	missense	probably damaging	1.00
R7539:Pik3c2a	UTSW	7	116340096	missense	probably damaging	0.97
R7684:Pik3c2a	UTSW	7	116388077	nonsense	probably null
R7737:Pik3c2a	UTSW	7	116356253	missense	probably damaging	0.99
R7739:Pik3c2a	UTSW	7	116394294	missense	probably benign	0.26
R7852:Pik3c2a	UTSW	7	116417458	missense	probably benign
R7922:Pik3c2a	UTSW	7	116391282	missense	probably damaging	1.00
R7956:Pik3c2a	UTSW	7	116350115	missense	probably benign	0.01
R8005:Pik3c2a	UTSW	7	116418036	missense	probably damaging	1.00
R8158:Pik3c2a	UTSW	7	116342997	missense	probably benign	0.00
R8329:Pik3c2a	UTSW	7	116418048	missense	probably damaging	1.00
R8478:Pik3c2a	UTSW	7	116418349	missense	probably damaging	0.96
R8736:Pik3c2a	UTSW	7	116376229	missense	possibly damaging	0.47
R8812:Pik3c2a	UTSW	7	116351877	missense	probably damaging	1.00
R8922:Pik3c2a	UTSW	7	116418424	missense	probably damaging	1.00
R8953:Pik3c2a	UTSW	7	116388085	missense	probably benign	0.19
R9105:Pik3c2a	UTSW	7	116372814	missense	probably benign	0.00
R9111:Pik3c2a	UTSW	7	116394296	missense	probably damaging	0.99
R9152:Pik3c2a	UTSW	7	116417769	missense	probably benign	0.30
R9241:Pik3c2a	UTSW	7	116417880	missense	probably benign	0.02
R9301:Pik3c2a	UTSW	7	116346178	missense	probably damaging	1.00
R9325:Pik3c2a	UTSW	7	116391323	missense	probably damaging	0.99
R9482:Pik3c2a	UTSW	7	116362054	missense	probably benign	0.04
R9513:Pik3c2a	UTSW	7	116340086	missense	probably benign	0.06
R9569:Pik3c2a	UTSW	7	116358704	missense	possibly damaging	0.89
R9758:Pik3c2a	UTSW	7	116346192	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTAAAGACGGTTACCAGTGAG -3'
(R):5'- CCACTGTTGAATATGTCTTTGAGG -3'

Sequencing Primer
(F):5'- CGGTTACCAGTGAGAGAAGGTTAAG -3'
(R):5'- TCTGTTCCAATGATGAAGTTGC -3'

Posted On

2014-08-25