Incidental Mutation 'R2015:Pls1'
ID222828
Institutional Source Beutler Lab
Gene Symbol Pls1
Ensembl Gene ENSMUSG00000049493
Gene Nameplastin 1 (I-isoform)
SynonymsI-fimbrin
MMRRC Submission 040024-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R2015 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location95752642-95845311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95761365 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 527 (V527A)
Ref Sequence ENSEMBL: ENSMUSP00000091317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093800]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093800
AA Change: V527A

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091317
Gene: ENSMUSG00000049493
AA Change: V527A

DomainStartEndE-ValueType
EFh 15 43 8.5e-5 SMART
EFh 55 83 1.73e-5 SMART
low complexity region 100 116 N/A INTRINSIC
CH 124 236 3.69e-23 SMART
CH 268 375 4.4e-21 SMART
CH 398 503 7.27e-22 SMART
CH 519 624 3.75e-15 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by this gene is a third distinct plastin isoform, which is specifically expressed at high levels in the small intestine. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous inactivation for this gene leads to altered intestinal morphology and physiology, increased brush border fragility and susceptibility to induced colitis, as well as a moderate and progressive form of hearing loss associated with defects in stereocilia morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C A 11: 101,987,218 H35Q probably damaging Het
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
Abca9 A T 11: 110,131,846 M1022K probably benign Het
Abhd4 T A 14: 54,262,832 H74Q probably damaging Het
Actg1 A G 11: 120,346,810 S49P possibly damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Aire T C 10: 78,042,958 D85G probably damaging Het
Akr1c18 T A 13: 4,145,309 D50V probably damaging Het
Ankrd13a C A 5: 114,792,109 A185E probably damaging Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Armc8 A T 9: 99,483,105 C661* probably null Het
Bbs10 C T 10: 111,300,855 Q610* probably null Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Bpifb9a T C 2: 154,268,200 probably null Het
Cdk14 T C 5: 5,380,082 K15R probably benign Het
Cdr1 A G X: 61,184,814 F249L probably benign Het
Cep250 A C 2: 155,981,453 H1009P probably damaging Het
Clasp2 A G 9: 113,911,500 T495A possibly damaging Het
Col19a1 C G 1: 24,559,753 G53A unknown Het
Cpne1 G A 2: 156,078,388 R166C probably damaging Het
Dtx3l G A 16: 35,936,427 H129Y probably benign Het
Ercc3 A G 18: 32,248,429 T433A probably benign Het
Gm9936 T A 5: 114,857,421 probably benign Het
Grina T C 15: 76,248,534 V167A probably damaging Het
Hcfc2 A G 10: 82,738,980 N618D probably benign Het
Herpud1 T C 8: 94,392,206 V196A probably benign Het
Hist3h2a T A 11: 58,954,928 L64Q probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Igll1 A G 16: 16,863,775 S39P probably benign Het
Kdm5a T C 6: 120,431,990 S1545P probably benign Het
Klra8 C A 6: 130,115,573 C255F probably damaging Het
Krtap4-6 A T 11: 99,665,572 C110S unknown Het
Lef1 T A 3: 131,111,587 I39N probably damaging Het
Lnpep G A 17: 17,579,063 T110I probably damaging Het
Lrp1 T A 10: 127,540,694 T4282S probably benign Het
Lrp6 A G 6: 134,480,374 probably null Het
Ly6g5b A C 17: 35,114,678 S53A possibly damaging Het
M6pr T G 6: 122,313,373 N98K probably damaging Het
Mal2 T C 15: 54,600,740 *176Q probably null Het
Mansc1 T C 6: 134,610,311 D301G possibly damaging Het
March1 C A 8: 66,121,821 N11K probably damaging Het
Mast3 T A 8: 70,787,363 I338F probably benign Het
Mcm3 A G 1: 20,803,580 L772P probably damaging Het
Mib2 C T 4: 155,657,880 G176D probably damaging Het
Mier2 A T 10: 79,541,202 probably null Het
Mogs C T 6: 83,117,650 R483* probably null Het
Msl2 G T 9: 101,075,251 probably benign Het
Naa16 A T 14: 79,345,059 M530K probably damaging Het
Nde1 A T 16: 14,169,457 probably benign Het
Ndufb10 T C 17: 24,722,529 probably null Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Npffr2 T A 5: 89,582,892 I227N probably damaging Het
Nup210l T A 3: 90,185,432 L1231Q probably damaging Het
Olfr1355 T C 10: 78,879,388 I72T possibly damaging Het
Olfr453 A G 6: 42,744,850 E271G probably damaging Het
Pclo C A 5: 14,521,501 P300Q probably damaging Het
Pik3c2a T A 7: 116,350,931 probably null Het
Plekha5 T A 6: 140,534,564 probably null Het
Ppfia2 T C 10: 106,474,677 M15T probably benign Het
Prkd2 T A 7: 16,847,677 C152* probably null Het
Ptprq T G 10: 107,667,422 K792Q probably damaging Het
Rbbp8 T C 18: 11,720,624 M296T probably benign Het
Rfc3 T C 5: 151,647,538 probably null Het
Rnf17 A G 14: 56,486,969 N1090S probably benign Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Sdsl G A 5: 120,463,153 T18M probably damaging Het
Sepsecs T A 5: 52,647,624 Q365L probably benign Het
Sgta A T 10: 81,051,296 V45E probably damaging Het
Slc25a46 A T 18: 31,609,725 H29Q probably benign Het
Slc2a8 A C 2: 32,981,380 V136G probably benign Het
Smg7 A T 1: 152,860,508 N166K probably damaging Het
Spata21 C T 4: 141,107,329 Q505* probably null Het
Strn4 T C 7: 16,833,028 S458P possibly damaging Het
Tbc1d22a C T 15: 86,299,684 T248M probably damaging Het
Trabd T A 15: 89,084,726 M149K possibly damaging Het
Trpv3 A T 11: 73,279,827 N178Y probably damaging Het
Try5 C T 6: 41,314,651 probably null Het
Tsg101 C T 7: 46,908,904 probably null Het
Ube3b A G 5: 114,411,149 E738G probably damaging Het
Unc13d A G 11: 116,068,755 S631P probably damaging Het
Unc5d T C 8: 28,758,979 T297A probably damaging Het
Usp18 A T 6: 121,268,550 E1V probably damaging Het
Vapb C A 2: 173,771,598 P97T probably benign Het
Vmn1r33 T A 6: 66,612,372 D66V probably benign Het
Vmn2r19 T A 6: 123,315,995 M332K probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vwde C A 6: 13,208,338 G182C possibly damaging Het
Wdfy3 A C 5: 101,860,486 S2778A probably null Het
Zbtb2 T A 10: 4,369,757 I90F possibly damaging Het
Zfp518b C A 5: 38,672,002 V887F probably benign Het
Zfp790 A G 7: 29,828,861 T324A probably benign Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Pls1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pls1 APN 9 95782419 missense possibly damaging 0.95
IGL00836:Pls1 APN 9 95761422 missense possibly damaging 0.86
IGL01391:Pls1 APN 9 95773698 missense probably benign 0.38
IGL02335:Pls1 APN 9 95784183 missense probably benign 0.32
IGL02875:Pls1 APN 9 95754351 missense possibly damaging 0.93
IGL03081:Pls1 APN 9 95773643 missense probably damaging 1.00
IGL03271:Pls1 APN 9 95776830 missense probably benign 0.04
PIT4585001:Pls1 UTSW 9 95761390 missense probably benign
R0048:Pls1 UTSW 9 95787063 missense probably damaging 1.00
R0088:Pls1 UTSW 9 95795768 missense possibly damaging 0.93
R0409:Pls1 UTSW 9 95786919 splice site probably benign
R2516:Pls1 UTSW 9 95776563 missense probably benign 0.00
R2985:Pls1 UTSW 9 95785582 missense possibly damaging 0.73
R3964:Pls1 UTSW 9 95785612 missense probably benign 0.00
R3965:Pls1 UTSW 9 95785612 missense probably benign 0.00
R5240:Pls1 UTSW 9 95776622 splice site probably null
R5681:Pls1 UTSW 9 95787012 missense probably damaging 1.00
R6399:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6441:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6496:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6498:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6499:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R7016:Pls1 UTSW 9 95786941 missense probably damaging 1.00
R7177:Pls1 UTSW 9 95773559 missense probably benign 0.01
R7458:Pls1 UTSW 9 95785507 missense probably damaging 1.00
R7467:Pls1 UTSW 9 95769113 missense possibly damaging 0.78
R7536:Pls1 UTSW 9 95762057 missense probably damaging 1.00
R7553:Pls1 UTSW 9 95787087 missense probably damaging 1.00
R7691:Pls1 UTSW 9 95773673 missense probably benign 0.21
R7756:Pls1 UTSW 9 95776844 missense probably benign 0.44
R7758:Pls1 UTSW 9 95776844 missense probably benign 0.44
R7876:Pls1 UTSW 9 95785505 nonsense probably null
R8269:Pls1 UTSW 9 95761970 missense probably damaging 1.00
Z1177:Pls1 UTSW 9 95754387 missense probably damaging 0.99
Z1177:Pls1 UTSW 9 95785618 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCATATGTTTCTGGGGTCTCATAC -3'
(R):5'- TTCTGGAGACGGGAACTTGC -3'

Sequencing Primer
(F):5'- TGGGGTCTCATACTAATATAACTCTG -3'
(R):5'- AGACGGGAACTTGCCATCCTG -3'
Posted On2014-08-25