Incidental Mutation 'R2015:Zbtb2'
ID 222836
Institutional Source Beutler Lab
Gene Symbol Zbtb2
Ensembl Gene ENSMUSG00000075327
Gene Name zinc finger and BTB domain containing 2
Synonyms LOC381990
MMRRC Submission 040024-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.882) question?
Stock # R2015 (G1)
Quality Score 212
Status Not validated
Chromosome 10
Chromosomal Location 4317075-4338108 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 4319757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 90 (I90F)
Ref Sequence ENSEMBL: ENSMUSP00000097656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100077] [ENSMUST00000100078]
AlphaFold Q3V3W4
Predicted Effect possibly damaging
Transcript: ENSMUST00000100077
AA Change: I90F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097655
Gene: ENSMUSG00000075327
AA Change: I90F

DomainStartEndE-ValueType
BTB 24 117 1.45e-12 SMART
low complexity region 201 220 N/A INTRINSIC
ZnF_C2H2 254 276 4.87e-4 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 390 410 1.06e2 SMART
ZnF_C2H2 448 468 2.41e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100078
AA Change: I90F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097656
Gene: ENSMUSG00000075327
AA Change: I90F

DomainStartEndE-ValueType
BTB 24 117 1.45e-12 SMART
low complexity region 201 220 N/A INTRINSIC
ZnF_C2H2 254 276 4.87e-4 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 390 410 1.06e2 SMART
ZnF_C2H2 448 468 2.41e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215860
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,022,672 (GRCm39) M1022K probably benign Het
Abhd4 T A 14: 54,500,289 (GRCm39) H74Q probably damaging Het
Actg1 A G 11: 120,237,636 (GRCm39) S49P possibly damaging Het
Adcy8 C T 15: 64,639,727 (GRCm39) G678S probably benign Het
Aire T C 10: 77,878,792 (GRCm39) D85G probably damaging Het
Akr1c18 T A 13: 4,195,308 (GRCm39) D50V probably damaging Het
Ankrd13a C A 5: 114,930,170 (GRCm39) A185E probably damaging Het
Apc A G 18: 34,448,644 (GRCm39) I1813V probably damaging Het
Armc8 A T 9: 99,365,158 (GRCm39) C661* probably null Het
Bbs10 C T 10: 111,136,716 (GRCm39) Q610* probably null Het
Blm T C 7: 80,152,147 (GRCm39) E600G probably damaging Het
Bpifb9a T C 2: 154,110,120 (GRCm39) probably null Het
Cdk14 T C 5: 5,430,082 (GRCm39) K15R probably benign Het
Cdr1 A G X: 60,228,420 (GRCm39) F249L probably benign Het
Cep250 A C 2: 155,823,373 (GRCm39) H1009P probably damaging Het
Cfap97d1 C A 11: 101,878,044 (GRCm39) H35Q probably damaging Het
Clasp2 A G 9: 113,740,568 (GRCm39) T495A possibly damaging Het
Col19a1 C G 1: 24,598,834 (GRCm39) G53A unknown Het
Cpne1 G A 2: 155,920,308 (GRCm39) R166C probably damaging Het
Dtx3l G A 16: 35,756,797 (GRCm39) H129Y probably benign Het
Ercc3 A G 18: 32,381,482 (GRCm39) T433A probably benign Het
Gm9936 T A 5: 114,995,482 (GRCm39) probably benign Het
Grina T C 15: 76,132,734 (GRCm39) V167A probably damaging Het
H2ac25 T A 11: 58,845,754 (GRCm39) L64Q probably damaging Het
Hcfc2 A G 10: 82,574,814 (GRCm39) N618D probably benign Het
Herpud1 T C 8: 95,118,834 (GRCm39) V196A probably benign Het
Hlcs A G 16: 94,063,599 (GRCm39) V487A probably benign Het
Hspa9 A T 18: 35,079,701 (GRCm39) Y243N probably damaging Het
Igll1 A G 16: 16,681,639 (GRCm39) S39P probably benign Het
Kdm5a T C 6: 120,408,951 (GRCm39) S1545P probably benign Het
Klra8 C A 6: 130,092,536 (GRCm39) C255F probably damaging Het
Krtap4-6 A T 11: 99,556,398 (GRCm39) C110S unknown Het
Lef1 T A 3: 130,905,236 (GRCm39) I39N probably damaging Het
Lnpep G A 17: 17,799,325 (GRCm39) T110I probably damaging Het
Lrp1 T A 10: 127,376,563 (GRCm39) T4282S probably benign Het
Lrp6 A G 6: 134,457,337 (GRCm39) probably null Het
Ly6g5b A C 17: 35,333,654 (GRCm39) S53A possibly damaging Het
M6pr T G 6: 122,290,332 (GRCm39) N98K probably damaging Het
Mal2 T C 15: 54,464,136 (GRCm39) *176Q probably null Het
Mansc1 T C 6: 134,587,274 (GRCm39) D301G possibly damaging Het
Marchf1 C A 8: 66,574,473 (GRCm39) N11K probably damaging Het
Mast3 T A 8: 71,240,007 (GRCm39) I338F probably benign Het
Mcm3 A G 1: 20,873,804 (GRCm39) L772P probably damaging Het
Mib2 C T 4: 155,742,337 (GRCm39) G176D probably damaging Het
Mier2 A T 10: 79,377,036 (GRCm39) probably null Het
Mogs C T 6: 83,094,631 (GRCm39) R483* probably null Het
Msl2 G T 9: 100,957,304 (GRCm39) probably benign Het
Naa16 A T 14: 79,582,499 (GRCm39) M530K probably damaging Het
Nde1 A T 16: 13,987,321 (GRCm39) probably benign Het
Ndufb10 T C 17: 24,941,503 (GRCm39) probably null Het
Nhsl1 A T 10: 18,387,340 (GRCm39) R205W probably damaging Het
Npffr2 T A 5: 89,730,751 (GRCm39) I227N probably damaging Het
Nup210l T A 3: 90,092,739 (GRCm39) L1231Q probably damaging Het
Or2f1 A G 6: 42,721,784 (GRCm39) E271G probably damaging Het
Or7a39 T C 10: 78,715,222 (GRCm39) I72T possibly damaging Het
Pclo C A 5: 14,571,515 (GRCm39) P300Q probably damaging Het
Pik3c2a T A 7: 115,950,166 (GRCm39) probably null Het
Plekha5 T A 6: 140,480,290 (GRCm39) probably null Het
Pls1 A G 9: 95,643,418 (GRCm39) V527A possibly damaging Het
Ppfia2 T C 10: 106,310,538 (GRCm39) M15T probably benign Het
Prkd2 T A 7: 16,581,602 (GRCm39) C152* probably null Het
Ptprq T G 10: 107,503,283 (GRCm39) K792Q probably damaging Het
Pttg1ip2 T A 5: 5,505,964 (GRCm39) I106L probably benign Het
Rbbp8 T C 18: 11,853,681 (GRCm39) M296T probably benign Het
Rfc3 T C 5: 151,571,003 (GRCm39) probably null Het
Rnf17 A G 14: 56,724,426 (GRCm39) N1090S probably benign Het
Sash1 A T 10: 8,605,177 (GRCm39) V1071D probably benign Het
Sdsl G A 5: 120,601,218 (GRCm39) T18M probably damaging Het
Sepsecs T A 5: 52,804,966 (GRCm39) Q365L probably benign Het
Sgta A T 10: 80,887,130 (GRCm39) V45E probably damaging Het
Slc25a46 A T 18: 31,742,778 (GRCm39) H29Q probably benign Het
Slc2a8 A C 2: 32,871,392 (GRCm39) V136G probably benign Het
Smg7 A T 1: 152,736,259 (GRCm39) N166K probably damaging Het
Spata21 C T 4: 140,834,640 (GRCm39) Q505* probably null Het
Strn4 T C 7: 16,566,953 (GRCm39) S458P possibly damaging Het
Tbc1d22a C T 15: 86,183,885 (GRCm39) T248M probably damaging Het
Trabd T A 15: 88,968,929 (GRCm39) M149K possibly damaging Het
Trpv3 A T 11: 73,170,653 (GRCm39) N178Y probably damaging Het
Try5 C T 6: 41,291,585 (GRCm39) probably null Het
Tsg101 C T 7: 46,558,652 (GRCm39) probably null Het
Ube3b A G 5: 114,549,210 (GRCm39) E738G probably damaging Het
Unc13d A G 11: 115,959,581 (GRCm39) S631P probably damaging Het
Unc5d T C 8: 29,249,007 (GRCm39) T297A probably damaging Het
Usp18 A T 6: 121,245,509 (GRCm39) E1V probably damaging Het
Vapb C A 2: 173,613,391 (GRCm39) P97T probably benign Het
Vmn1r33 T A 6: 66,589,356 (GRCm39) D66V probably benign Het
Vmn2r19 T A 6: 123,292,954 (GRCm39) M332K probably benign Het
Vmn2r71 T A 7: 85,269,845 (GRCm39) M452K probably benign Het
Vps13b T C 15: 35,607,288 (GRCm39) S1074P probably damaging Het
Vwde C A 6: 13,208,337 (GRCm39) G182C possibly damaging Het
Wdfy3 A C 5: 102,008,352 (GRCm39) S2778A probably null Het
Zfp518b C A 5: 38,829,345 (GRCm39) V887F probably benign Het
Zfp790 A G 7: 29,528,286 (GRCm39) T324A probably benign Het
Zup1 A G 10: 33,805,820 (GRCm39) V437A possibly damaging Het
Other mutations in Zbtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Zbtb2 APN 10 4,319,702 (GRCm39) missense probably benign 0.28
IGL02340:Zbtb2 APN 10 4,318,712 (GRCm39) missense probably damaging 0.98
PIT4142001:Zbtb2 UTSW 10 4,319,493 (GRCm39) missense probably benign 0.00
PIT4581001:Zbtb2 UTSW 10 4,319,265 (GRCm39) missense possibly damaging 0.77
R1436:Zbtb2 UTSW 10 4,318,697 (GRCm39) missense probably benign 0.01
R2570:Zbtb2 UTSW 10 4,318,673 (GRCm39) missense probably damaging 1.00
R5134:Zbtb2 UTSW 10 4,319,267 (GRCm39) missense possibly damaging 0.48
R5275:Zbtb2 UTSW 10 4,318,508 (GRCm39) missense probably damaging 1.00
R5286:Zbtb2 UTSW 10 4,318,566 (GRCm39) missense possibly damaging 0.66
R5295:Zbtb2 UTSW 10 4,318,508 (GRCm39) missense probably damaging 1.00
R5328:Zbtb2 UTSW 10 4,319,267 (GRCm39) missense possibly damaging 0.48
R5475:Zbtb2 UTSW 10 4,319,275 (GRCm39) missense probably benign 0.18
R5719:Zbtb2 UTSW 10 4,319,456 (GRCm39) missense probably benign 0.22
R5907:Zbtb2 UTSW 10 4,318,592 (GRCm39) missense possibly damaging 0.52
R6033:Zbtb2 UTSW 10 4,318,599 (GRCm39) missense probably damaging 0.97
R6033:Zbtb2 UTSW 10 4,318,599 (GRCm39) missense probably damaging 0.97
R6492:Zbtb2 UTSW 10 4,319,711 (GRCm39) missense probably damaging 1.00
R7016:Zbtb2 UTSW 10 4,318,646 (GRCm39) missense probably damaging 1.00
R7287:Zbtb2 UTSW 10 4,318,986 (GRCm39) missense possibly damaging 0.77
R7348:Zbtb2 UTSW 10 4,324,574 (GRCm39) missense possibly damaging 0.48
R7486:Zbtb2 UTSW 10 4,319,025 (GRCm39) nonsense probably null
R8316:Zbtb2 UTSW 10 4,319,084 (GRCm39) missense probably benign 0.02
R9031:Zbtb2 UTSW 10 4,319,183 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTGTCTCAGCTGATGGTC -3'
(R):5'- TTGTTCTGCTGAGCTCTGAAC -3'

Sequencing Primer
(F):5'- GTCTGCAATCTGAATGCCGTACAAG -3'
(R):5'- AACTGGGTCTGTGACTACGCTC -3'
Posted On 2014-08-25