Incidental Mutation 'R1988:Crx'
ID222837
Institutional Source Beutler Lab
Gene Symbol Crx
Ensembl Gene ENSMUSG00000041578
Gene Namecone-rod homeobox
SynonymsCrx1
MMRRC Submission 040000-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R1988 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location15865947-15879968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15869347 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 107 (V107D)
Ref Sequence ENSEMBL: ENSMUSP00000134400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044434] [ENSMUST00000132563] [ENSMUST00000172758] [ENSMUST00000174318]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044434
AA Change: V83D

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043436
Gene: ENSMUSG00000041578
AA Change: V83D

DomainStartEndE-ValueType
HOX 39 101 2.39e-24 SMART
low complexity region 139 153 N/A INTRINSIC
Pfam:TF_Otx 164 250 1.1e-15 PFAM
internal_repeat_1 260 278 1.41e-5 PROSPERO
internal_repeat_1 279 296 1.41e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000132563
AA Change: V83D

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133833
Gene: ENSMUSG00000041578
AA Change: V83D

DomainStartEndE-ValueType
HOX 39 101 2.39e-24 SMART
low complexity region 139 153 N/A INTRINSIC
low complexity region 196 207 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165905
AA Change: V107D

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126642
Gene: ENSMUSG00000041578
AA Change: V107D

DomainStartEndE-ValueType
HOX 63 125 2.39e-24 SMART
low complexity region 163 177 N/A INTRINSIC
Pfam:TF_Otx 188 273 1.9e-17 PFAM
internal_repeat_1 284 302 2.45e-5 PROSPERO
internal_repeat_1 303 320 2.45e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000172758
SMART Domains Protein: ENSMUSP00000134463
Gene: ENSMUSG00000041578

DomainStartEndE-ValueType
HOX 39 74 6.07e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174318
AA Change: V107D

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134400
Gene: ENSMUSG00000041578
AA Change: V107D

DomainStartEndE-ValueType
HOX 39 101 2.39e-24 SMART
low complexity region 139 153 N/A INTRINSIC
Pfam:TF_Otx 164 250 1.1e-15 PFAM
internal_repeat_1 260 278 1.41e-5 PROSPERO
internal_repeat_1 279 296 1.41e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174358
Meta Mutation Damage Score 0.9057 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a photoreceptor-specific transcription factor which plays a role in the differentiation of photoreceptor cells. This homeodomain protein is necessary for the maintenance of normal cone and rod function. Mutations in this gene are associated with photoreceptor degeneration, Leber congenital amaurosis type III and the autosomal dominant cone-rod dystrophy 2. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a lack of photoreceptor outer segments and rod and cone activity, reduced expression of several photoreceptor- and pineal-specific genes, and altered circadian behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,896 D216V possibly damaging Het
2610021A01Rik C T 7: 41,626,657 R595* probably null Het
Adgrl3 A G 5: 81,688,567 D724G probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Akt1 T C 12: 112,655,151 I404V probably benign Het
Anxa13 T A 15: 58,341,948 noncoding transcript Het
Atoh1 T C 6: 64,729,633 V104A probably benign Het
Brwd1 T C 16: 96,021,237 D1256G probably damaging Het
C9 ATTTT ATTT 15: 6,483,138 probably null Het
Cd164 A G 10: 41,523,181 T89A probably benign Het
Cep350 G C 1: 155,933,104 N575K possibly damaging Het
Chrm5 A G 2: 112,480,252 V173A probably damaging Het
Cnot1 A G 8: 95,741,944 V1417A possibly damaging Het
Cntnap3 T C 13: 64,758,390 T801A probably damaging Het
Cntnap5b A C 1: 100,072,140 K208Q possibly damaging Het
Csrnp2 A G 15: 100,489,440 F49S probably damaging Het
Ctbp1 A G 5: 33,250,904 L228P possibly damaging Het
Ctdp1 A T 18: 80,449,401 D626E possibly damaging Het
Cyp1a2 T C 9: 57,682,286 T82A possibly damaging Het
Dnah3 T A 7: 119,967,570 T2478S possibly damaging Het
Dnah3 T G 7: 119,967,959 D2348A probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 A G 6: 73,092,192 I2504T probably damaging Het
Dnase1l2 A C 17: 24,441,651 W138G probably damaging Het
Dopey2 T A 16: 93,766,173 I855N probably damaging Het
Dsc3 T A 18: 19,965,846 N759Y possibly damaging Het
Dtx2 C T 5: 136,032,293 R510* probably null Het
Fat4 G T 3: 38,887,115 M52I probably benign Het
Fat4 G A 3: 38,996,090 E4034K probably damaging Het
Fezf2 T C 14: 12,344,350 K279R probably damaging Het
Fsip2 G T 2: 82,976,517 W1060L possibly damaging Het
G6pc T A 11: 101,367,942 I49N probably damaging Het
Gars A G 6: 55,077,772 E688G probably null Het
Gdf11 T C 10: 128,885,242 N361S probably benign Het
Gli3 A C 13: 15,726,380 M1451L probably benign Het
Heatr3 T C 8: 88,150,317 I329T probably benign Het
Herc3 T G 6: 58,884,975 probably null Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Igsf3 A T 3: 101,431,296 I309F probably benign Het
Kif21b C T 1: 136,152,264 R513W probably damaging Het
Kif7 G T 7: 79,699,241 H1195Q probably benign Het
Lpcat4 T C 2: 112,242,542 V182A possibly damaging Het
Map3k21 T A 8: 125,927,555 I371N probably benign Het
Mns1 G A 9: 72,448,759 probably null Het
Myo3a A G 2: 22,578,128 T465A possibly damaging Het
Nlrc4 A T 17: 74,426,943 S992T probably benign Het
Notch4 G A 17: 34,587,588 G1833E possibly damaging Het
Olfr160 A T 9: 37,711,697 I194K possibly damaging Het
Olfr467 A T 7: 107,814,700 I39L probably benign Het
Olfr600 T A 7: 103,346,109 Y273F possibly damaging Het
Olfr666 T C 7: 104,892,903 T242A probably damaging Het
Olfr998 G A 2: 85,590,641 V34I probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pik3cd T A 4: 149,663,203 T28S probably damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Ppm1f T C 16: 16,923,666 S335P probably damaging Het
Prr16 C T 18: 51,303,277 P276L probably damaging Het
Rilp A G 11: 75,510,933 probably null Het
Rspry1 A G 8: 94,632,054 probably null Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Smyd5 T C 6: 85,438,136 I42T possibly damaging Het
Stk17b T C 1: 53,761,082 N246D probably damaging Het
Suco T C 1: 161,818,811 probably null Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tecpr1 C T 5: 144,204,697 V785M possibly damaging Het
Telo2 C T 17: 25,101,668 V756I probably benign Het
Tgm1 C T 14: 55,705,577 R602H probably benign Het
Timeless A G 10: 128,244,187 T402A probably damaging Het
Tnfaip2 T A 12: 111,449,891 probably null Het
Trim5 A G 7: 104,265,621 S414P probably damaging Het
Txnip A G 3: 96,559,750 T247A possibly damaging Het
Vmn1r174 A T 7: 23,754,625 T239S probably damaging Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Zranb3 A T 1: 127,959,743 N982K probably benign Het
Other mutations in Crx
AlleleSourceChrCoordTypePredicted EffectPPH Score
Typhlotic UTSW 7 15868107 nonsense probably null
R0437:Crx UTSW 7 15871146 nonsense probably null
R0729:Crx UTSW 7 15871133 splice site probably benign
R1601:Crx UTSW 7 15867811 unclassified probably null
R1898:Crx UTSW 7 15868223 missense probably damaging 1.00
R1933:Crx UTSW 7 15868376 nonsense probably null
R5272:Crx UTSW 7 15868285 missense probably damaging 0.99
R5326:Crx UTSW 7 15868337 missense probably damaging 1.00
R5542:Crx UTSW 7 15868337 missense probably damaging 1.00
R6134:Crx UTSW 7 15868107 nonsense probably null
R7313:Crx UTSW 7 15867932 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCATGCACGTATGAACAC -3'
(R):5'- CCTGAGGGTTCTTTAATTTGCC -3'

Sequencing Primer
(F):5'- CTCAGTGGTAGAGCATACACCTG -3'
(R):5'- AATTTGCCCCCGCTTAGGTG -3'
Posted On2014-08-25