Mutagenetix > Incidental Mutations

Incidental Mutation 'R1988:Dnah3'

222852

Institutional Source

Beutler Lab

Gene Symbol

Dnah3

Ensembl Gene

ENSMUSG00000052273

Gene Name

dynein, axonemal, heavy chain 3

Synonyms

MMRRC Submission

040000-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R1988 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119922671-120095280 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119967570 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 2478 (T2478S)

Ref Sequence

ENSEMBL: ENSMUSP00000042857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000209154] [ENSMUST00000213149]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046993
AA Change: T2478S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: T2478S

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC
low complexity region	805	820	N/A	INTRINSIC
Pfam:DHC_N2	826	1235	3.3e-144	PFAM
AAA	1388	1527	1.59e-1	SMART
low complexity region	1594	1606	N/A	INTRINSIC
Blast:AAA	1669	1897	9e-84	BLAST
AAA	2033	2180	1.33e-3	SMART
Pfam:AAA_8	2362	2632	1.5e-63	PFAM
Pfam:MT	2644	2994	7.4e-52	PFAM
Pfam:AAA_9	3015	3240	3.5e-92	PFAM
low complexity region	3338	3349	N/A	INTRINSIC
Pfam:Dynein_heavy	3376	4079	4.4e-285	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157547

Predicted Effect

unknown
Transcript: ENSMUST00000208910
AA Change: T91S

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209154
AA Change: T2467S

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000213149

Meta Mutation Damage Score

0.0814

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.1%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	A	6: 146,952,896	D216V	possibly damaging	Het
2610021A01Rik	C	T	7: 41,626,657	R595*	probably null	Het
Adgrl3	A	G	5: 81,688,567	D724G	probably damaging	Het
Akap6	T	C	12: 53,140,795	F1664S	possibly damaging	Het
Akt1	T	C	12: 112,655,151	I404V	probably benign	Het
Anxa13	T	A	15: 58,341,948		noncoding transcript	Het
Atoh1	T	C	6: 64,729,633	V104A	probably benign	Het
Brwd1	T	C	16: 96,021,237	D1256G	probably damaging	Het
C9	ATTTT	ATTT	15: 6,483,138		probably null	Het
Cd164	A	G	10: 41,523,181	T89A	probably benign	Het
Cep350	G	C	1: 155,933,104	N575K	possibly damaging	Het
Chrm5	A	G	2: 112,480,252	V173A	probably damaging	Het
Cnot1	A	G	8: 95,741,944	V1417A	possibly damaging	Het
Cntnap3	T	C	13: 64,758,390	T801A	probably damaging	Het
Cntnap5b	A	C	1: 100,072,140	K208Q	possibly damaging	Het
Crx	A	T	7: 15,869,347	V107D	possibly damaging	Het
Csrnp2	A	G	15: 100,489,440	F49S	probably damaging	Het
Ctbp1	A	G	5: 33,250,904	L228P	possibly damaging	Het
Ctdp1	A	T	18: 80,449,401	D626E	possibly damaging	Het
Cyp1a2	T	C	9: 57,682,286	T82A	possibly damaging	Het
Dnah5	T	C	15: 28,343,591	I2379T	probably damaging	Het
Dnah6	A	G	6: 73,092,192	I2504T	probably damaging	Het
Dnase1l2	A	C	17: 24,441,651	W138G	probably damaging	Het
Dopey2	T	A	16: 93,766,173	I855N	probably damaging	Het
Dsc3	T	A	18: 19,965,846	N759Y	possibly damaging	Het
Dtx2	C	T	5: 136,032,293	R510*	probably null	Het
Fat4	G	T	3: 38,887,115	M52I	probably benign	Het
Fat4	G	A	3: 38,996,090	E4034K	probably damaging	Het
Fezf2	T	C	14: 12,344,350	K279R	probably damaging	Het
Fsip2	G	T	2: 82,976,517	W1060L	possibly damaging	Het
G6pc	T	A	11: 101,367,942	I49N	probably damaging	Het
Gars	A	G	6: 55,077,772	E688G	probably null	Het
Gdf11	T	C	10: 128,885,242	N361S	probably benign	Het
Gli3	A	C	13: 15,726,380	M1451L	probably benign	Het
Heatr3	T	C	8: 88,150,317	I329T	probably benign	Het
Herc3	T	G	6: 58,884,975		probably null	Het
Hrnr	A	G	3: 93,332,604	N3383S	unknown	Het
Igsf3	A	T	3: 101,431,296	I309F	probably benign	Het
Kif21b	C	T	1: 136,152,264	R513W	probably damaging	Het
Kif7	G	T	7: 79,699,241	H1195Q	probably benign	Het
Lpcat4	T	C	2: 112,242,542	V182A	possibly damaging	Het
Map3k21	T	A	8: 125,927,555	I371N	probably benign	Het
Mns1	G	A	9: 72,448,759		probably null	Het
Myo3a	A	G	2: 22,578,128	T465A	possibly damaging	Het
Nlrc4	A	T	17: 74,426,943	S992T	probably benign	Het
Notch4	G	A	17: 34,587,588	G1833E	possibly damaging	Het
Olfr160	A	T	9: 37,711,697	I194K	possibly damaging	Het
Olfr467	A	T	7: 107,814,700	I39L	probably benign	Het
Olfr600	T	A	7: 103,346,109	Y273F	possibly damaging	Het
Olfr666	T	C	7: 104,892,903	T242A	probably damaging	Het
Olfr998	G	A	2: 85,590,641	V34I	probably benign	Het
Pcdh9	G	A	14: 93,888,305	P143L	probably damaging	Het
Pik3cd	T	A	4: 149,663,203	T28S	probably damaging	Het
Pkd1	G	T	17: 24,576,592		probably null	Het
Plk4	A	T	3: 40,805,817	S383C	possibly damaging	Het
Plxna2	T	C	1: 194,643,989	L77P	probably damaging	Het
Ppm1f	T	C	16: 16,923,666	S335P	probably damaging	Het
Prr16	C	T	18: 51,303,277	P276L	probably damaging	Het
Rilp	A	G	11: 75,510,933		probably null	Het
Rspry1	A	G	8: 94,632,054		probably null	Het
Serpinb9b	T	C	13: 33,029,559	V33A	probably benign	Het
Slc4a10	C	A	2: 62,268,204	Q561K	probably damaging	Het
Smyd5	T	C	6: 85,438,136	I42T	possibly damaging	Het
Stk17b	T	C	1: 53,761,082	N246D	probably damaging	Het
Suco	T	C	1: 161,818,811		probably null	Het
Tcrg-C3	C	A	13: 19,260,994	F37L	probably damaging	Het
Tecpr1	C	T	5: 144,204,697	V785M	possibly damaging	Het
Telo2	C	T	17: 25,101,668	V756I	probably benign	Het
Tgm1	C	T	14: 55,705,577	R602H	probably benign	Het
Timeless	A	G	10: 128,244,187	T402A	probably damaging	Het
Tnfaip2	T	A	12: 111,449,891		probably null	Het
Trim5	A	G	7: 104,265,621	S414P	probably damaging	Het
Txnip	A	G	3: 96,559,750	T247A	possibly damaging	Het
Vmn1r174	A	T	7: 23,754,625	T239S	probably damaging	Het
Vmn1r231	T	A	17: 20,889,950	E234D	probably damaging	Het
Zranb3	A	T	1: 127,959,743	N982K	probably benign	Het

Other mutations in Dnah3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00650:Dnah3	APN	7	119938905	missense	possibly damaging	0.88
IGL01095:Dnah3	APN	7	119951597	missense	probably benign	0.02
IGL01329:Dnah3	APN	7	120022941	missense	probably damaging	1.00
IGL01380:Dnah3	APN	7	119926564	missense	probably damaging	1.00
IGL01410:Dnah3	APN	7	119967720	missense	possibly damaging	0.91
IGL01487:Dnah3	APN	7	119965530	nonsense	probably null
IGL01843:Dnah3	APN	7	119943575	missense	probably benign	0.12
IGL01929:Dnah3	APN	7	119951651	nonsense	probably null
IGL01994:Dnah3	APN	7	119951214	missense	possibly damaging	0.58
IGL02115:Dnah3	APN	7	120029054	missense	probably damaging	1.00
IGL02273:Dnah3	APN	7	119951271	missense	probably damaging	1.00
IGL02299:Dnah3	APN	7	119967579	missense	probably benign	0.39
IGL02421:Dnah3	APN	7	119950992	missense	possibly damaging	0.87
IGL02514:Dnah3	APN	7	119966247	missense	probably damaging	1.00
IGL02596:Dnah3	APN	7	119938914	missense	probably benign	0.19
IGL02716:Dnah3	APN	7	119937023	missense	probably damaging	0.97
IGL02738:Dnah3	APN	7	119965497	missense	probably benign
IGL03404:Dnah3	APN	7	119938977	missense	probably damaging	1.00
R0964_Dnah3_480	UTSW	7	119952739	splice site	probably benign
R1778_Dnah3_238	UTSW	7	120078402	missense	probably damaging	1.00
R4658_Dnah3_599	UTSW	7	119950651	missense	probably damaging	1.00
BB004:Dnah3	UTSW	7	119951271	missense	probably damaging	0.97
BB014:Dnah3	UTSW	7	119951271	missense	probably damaging	0.97
R0011:Dnah3	UTSW	7	120019701	missense	probably damaging	1.00
R0195:Dnah3	UTSW	7	120077775	critical splice donor site	probably null
R0241:Dnah3	UTSW	7	119922730	missense	probably damaging	1.00
R0241:Dnah3	UTSW	7	119922730	missense	probably damaging	1.00
R0312:Dnah3	UTSW	7	120045659	missense	probably damaging	1.00
R0316:Dnah3	UTSW	7	119965659	missense	possibly damaging	0.94
R0370:Dnah3	UTSW	7	120086720	missense	possibly damaging	0.91
R0426:Dnah3	UTSW	7	119943572	missense	probably benign	0.11
R0525:Dnah3	UTSW	7	119928754	missense	probably damaging	1.00
R0625:Dnah3	UTSW	7	120071887	missense	possibly damaging	0.68
R0627:Dnah3	UTSW	7	120020915	missense	probably damaging	1.00
R0632:Dnah3	UTSW	7	119967905	missense	probably benign	0.11
R0928:Dnah3	UTSW	7	120030051	missense	probably damaging	1.00
R0964:Dnah3	UTSW	7	119952739	splice site	probably benign
R0972:Dnah3	UTSW	7	120035340	splice site	probably null
R1066:Dnah3	UTSW	7	120061009	missense	probably damaging	1.00
R1082:Dnah3	UTSW	7	120078445	missense	probably damaging	1.00
R1127:Dnah3	UTSW	7	119923030	missense	probably damaging	1.00
R1132:Dnah3	UTSW	7	119939004	missense	possibly damaging	0.50
R1222:Dnah3	UTSW	7	120090676	missense	probably benign	0.28
R1420:Dnah3	UTSW	7	119951979	missense	probably damaging	0.99
R1456:Dnah3	UTSW	7	120047630	missense	probably damaging	1.00
R1472:Dnah3	UTSW	7	120070958	missense	probably benign	0.12
R1617:Dnah3	UTSW	7	120089946	missense	probably benign	0.01
R1624:Dnah3	UTSW	7	120019695	missense	probably damaging	0.99
R1654:Dnah3	UTSW	7	119926449	missense	probably damaging	1.00
R1673:Dnah3	UTSW	7	119971179	nonsense	probably null
R1677:Dnah3	UTSW	7	119928740	missense	probably damaging	1.00
R1687:Dnah3	UTSW	7	120045786	splice site	probably null
R1711:Dnah3	UTSW	7	120078571	missense	probably damaging	1.00
R1738:Dnah3	UTSW	7	120035359	missense	probably damaging	1.00
R1778:Dnah3	UTSW	7	120078402	missense	probably damaging	1.00
R1866:Dnah3	UTSW	7	119928856	splice site	probably null
R1883:Dnah3	UTSW	7	120077919	missense	probably benign	0.06
R1894:Dnah3	UTSW	7	120086334	missense	probably benign	0.05
R1929:Dnah3	UTSW	7	119975129	missense	probably benign	0.10
R1988:Dnah3	UTSW	7	119967959	missense	probably damaging	0.99
R2010:Dnah3	UTSW	7	120095177	start codon destroyed	probably benign	0.00
R2022:Dnah3	UTSW	7	119951242	missense	probably damaging	1.00
R2026:Dnah3	UTSW	7	120039406	missense	probably damaging	1.00
R2063:Dnah3	UTSW	7	119951909	missense	probably damaging	0.96
R2131:Dnah3	UTSW	7	119967759	missense	possibly damaging	0.93
R2152:Dnah3	UTSW	7	119952013	missense	probably benign	0.02
R2199:Dnah3	UTSW	7	119951569	missense	possibly damaging	0.89
R2271:Dnah3	UTSW	7	119975129	missense	probably benign	0.10
R2350:Dnah3	UTSW	7	120045788	splice site	probably null
R2567:Dnah3	UTSW	7	119952697	missense	possibly damaging	0.83
R2848:Dnah3	UTSW	7	119967938	missense	probably benign	0.01
R2902:Dnah3	UTSW	7	119951499	missense	possibly damaging	0.61
R2926:Dnah3	UTSW	7	119951115	missense	probably damaging	1.00
R2944:Dnah3	UTSW	7	119951110	missense	probably damaging	1.00
R3022:Dnah3	UTSW	7	120078481	missense	possibly damaging	0.93
R3401:Dnah3	UTSW	7	119967656	missense	probably benign	0.00
R3402:Dnah3	UTSW	7	119967656	missense	probably benign	0.00
R3403:Dnah3	UTSW	7	119967656	missense	probably benign	0.00
R3919:Dnah3	UTSW	7	119951080	missense	probably damaging	1.00
R3972:Dnah3	UTSW	7	120086720	missense	probably damaging	0.99
R4162:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4184:Dnah3	UTSW	7	120083293	missense	probably damaging	1.00
R4198:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4199:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4200:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4239:Dnah3	UTSW	7	120029025	nonsense	probably null
R4478:Dnah3	UTSW	7	120071863	missense	probably benign	0.00
R4579:Dnah3	UTSW	7	120009331	missense	probably damaging	1.00
R4600:Dnah3	UTSW	7	120089946	missense	probably benign
R4649:Dnah3	UTSW	7	120047698	missense	probably damaging	1.00
R4658:Dnah3	UTSW	7	119950651	missense	probably damaging	1.00
R4728:Dnah3	UTSW	7	120059366	missense	probably damaging	0.99
R4739:Dnah3	UTSW	7	120077946	missense	possibly damaging	0.54
R4758:Dnah3	UTSW	7	120079406	missense	probably benign	0.00
R4785:Dnah3	UTSW	7	119967824	missense	probably benign	0.29
R4789:Dnah3	UTSW	7	120011072	missense	probably damaging	1.00
R4930:Dnah3	UTSW	7	119951681	nonsense	probably null
R4935:Dnah3	UTSW	7	120016477	nonsense	probably null
R4946:Dnah3	UTSW	7	119931560	missense	probably damaging	1.00
R4981:Dnah3	UTSW	7	119956201	missense	probably benign	0.03
R4984:Dnah3	UTSW	7	119928779	missense	probably benign	0.04
R5025:Dnah3	UTSW	7	120071905	missense	probably benign	0.02
R5046:Dnah3	UTSW	7	119951580	missense	probably damaging	1.00
R5056:Dnah3	UTSW	7	120020946	missense	probably damaging	1.00
R5068:Dnah3	UTSW	7	120032790	missense	probably benign
R5069:Dnah3	UTSW	7	120032790	missense	probably benign
R5154:Dnah3	UTSW	7	119952419	missense	probably damaging	1.00
R5208:Dnah3	UTSW	7	120032638	missense	probably damaging	1.00
R5323:Dnah3	UTSW	7	120021011	missense	probably damaging	1.00
R5330:Dnah3	UTSW	7	119943648	missense	probably benign	0.00
R5385:Dnah3	UTSW	7	119924903	missense	probably damaging	1.00
R5391:Dnah3	UTSW	7	120090076	missense	probably benign	0.02
R5564:Dnah3	UTSW	7	119971466	critical splice donor site	probably null
R5594:Dnah3	UTSW	7	119971621	missense	possibly damaging	0.89
R5610:Dnah3	UTSW	7	119939065	splice site	probably null
R5673:Dnah3	UTSW	7	119951589	missense	possibly damaging	0.91
R5678:Dnah3	UTSW	7	120077851	missense	probably benign	0.00
R5737:Dnah3	UTSW	7	120059198	missense	probably benign	0.03
R5766:Dnah3	UTSW	7	119978222	missense	probably damaging	1.00
R5769:Dnah3	UTSW	7	120089952	nonsense	probably null
R5789:Dnah3	UTSW	7	119943599	missense	possibly damaging	0.70
R5791:Dnah3	UTSW	7	119931473	missense	probably benign	0.00
R5841:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5843:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5844:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5846:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5851:Dnah3	UTSW	7	120039362	missense	possibly damaging	0.51
R5853:Dnah3	UTSW	7	119938833	missense	probably damaging	1.00
R5857:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5865:Dnah3	UTSW	7	119975108	missense	probably benign	0.00
R5885:Dnah3	UTSW	7	120069704	missense	probably benign	0.10
R5898:Dnah3	UTSW	7	120078501	missense	probably benign	0.37
R5917:Dnah3	UTSW	7	120016526	missense	probably damaging	1.00
R5964:Dnah3	UTSW	7	119922880	missense	probably benign	0.00
R5990:Dnah3	UTSW	7	120073541	missense	probably benign
R6004:Dnah3	UTSW	7	120086297	missense	probably benign	0.10
R6033:Dnah3	UTSW	7	120071647	missense	probably benign	0.00
R6033:Dnah3	UTSW	7	120071647	missense	probably benign	0.00
R6045:Dnah3	UTSW	7	119967522	missense	probably damaging	0.99
R6056:Dnah3	UTSW	7	120030031	missense	probably damaging	1.00
R6133:Dnah3	UTSW	7	120086246	missense	probably benign	0.10
R6229:Dnah3	UTSW	7	119965488	missense	probably benign	0.11
R6237:Dnah3	UTSW	7	120009384	missense	probably damaging	1.00
R6333:Dnah3	UTSW	7	120054633	missense	probably damaging	1.00
R6408:Dnah3	UTSW	7	119922968	splice site	probably null
R6447:Dnah3	UTSW	7	119923054	missense	probably benign	0.12
R6606:Dnah3	UTSW	7	120060956	missense	probably benign	0.02
R6666:Dnah3	UTSW	7	120070949	missense	probably benign	0.16
R6733:Dnah3	UTSW	7	119922974	missense	probably benign	0.22
R6815:Dnah3	UTSW	7	119971727	missense	probably benign
R6882:Dnah3	UTSW	7	119971184	missense	possibly damaging	0.95
R6934:Dnah3	UTSW	7	120054601	critical splice donor site	probably null
R6966:Dnah3	UTSW	7	120032754	missense	probably damaging	1.00
R7025:Dnah3	UTSW	7	120030010	missense	possibly damaging	0.90
R7207:Dnah3	UTSW	7	119971089	missense	probably damaging	1.00
R7214:Dnah3	UTSW	7	119922742	missense	probably damaging	1.00
R7222:Dnah3	UTSW	7	120071523	missense	probably benign	0.00
R7235:Dnah3	UTSW	7	120032670	missense	probably damaging	1.00
R7241:Dnah3	UTSW	7	119943633	missense	probably benign	0.03
R7313:Dnah3	UTSW	7	119981344	missense	probably benign	0.39
R7342:Dnah3	UTSW	7	120029985	missense	probably damaging	1.00
R7368:Dnah3	UTSW	7	120029016	missense	probably benign
R7375:Dnah3	UTSW	7	119951677	missense	probably damaging	1.00
R7395:Dnah3	UTSW	7	119966251	missense
R7395:Dnah3	UTSW	7	120060960	missense	probably benign	0.00
R7431:Dnah3	UTSW	7	120051744	missense	probably damaging	1.00
R7499:Dnah3	UTSW	7	120060912	missense	probably damaging	0.99
R7515:Dnah3	UTSW	7	120073592	missense	probably benign	0.21
R7564:Dnah3	UTSW	7	119971594	missense	probably benign
R7618:Dnah3	UTSW	7	119978378	missense	probably damaging	0.97
R7697:Dnah3	UTSW	7	119967434	missense
R7728:Dnah3	UTSW	7	119938828	missense	probably damaging	1.00
R7757:Dnah3	UTSW	7	120071570	missense	probably benign
R7757:Dnah3	UTSW	7	119971215	splice site	probably null
R7774:Dnah3	UTSW	7	119951752	nonsense	probably null
R7804:Dnah3	UTSW	7	119952618	missense	probably damaging	1.00
R7804:Dnah3	UTSW	7	120011012	missense	probably damaging	1.00
R7857:Dnah3	UTSW	7	119951704	missense	probably damaging	1.00
R7871:Dnah3	UTSW	7	119967552	missense
R7903:Dnah3	UTSW	7	120042128	missense	probably damaging	1.00
R7927:Dnah3	UTSW	7	119951271	missense	probably damaging	0.97
R7989:Dnah3	UTSW	7	120077789	missense	probably benign
R8142:Dnah3	UTSW	7	120060966	missense	probably benign	0.00
R8164:Dnah3	UTSW	7	119967614	missense	probably damaging	1.00
R8237:Dnah3	UTSW	7	119926413	missense	probably benign	0.01
R8313:Dnah3	UTSW	7	119951152	missense	probably benign	0.38
R8338:Dnah3	UTSW	7	120071881	missense	probably benign	0.01
R8355:Dnah3	UTSW	7	119952208	missense	probably damaging	1.00
R8408:Dnah3	UTSW	7	119952505	missense	probably damaging	1.00
R8411:Dnah3	UTSW	7	120011030	missense	probably damaging	1.00
R8455:Dnah3	UTSW	7	119952208	missense	probably damaging	1.00
R8483:Dnah3	UTSW	7	119937030	missense	probably benign	0.00
R8531:Dnah3	UTSW	7	119951368	missense	probably damaging	1.00
R8885:Dnah3	UTSW	7	119962152	missense
R8912:Dnah3	UTSW	7	120090646	missense	probably benign	0.06
R8966:Dnah3	UTSW	7	119950658	nonsense	probably null
R8982:Dnah3	UTSW	7	119937071	missense	probably damaging	1.00
R9043:Dnah3	UTSW	7	119952049	missense	probably benign
R9053:Dnah3	UTSW	7	120019764	missense	possibly damaging	0.67
R9059:Dnah3	UTSW	7	120085145	missense	probably benign	0.01
R9182:Dnah3	UTSW	7	120085128	missense	probably damaging	0.98
R9365:Dnah3	UTSW	7	119967636	missense
R9383:Dnah3	UTSW	7	120047596	missense	probably benign	0.23
R9430:Dnah3	UTSW	7	120028982	missense	probably damaging	1.00
Z1088:Dnah3	UTSW	7	120010873	missense	probably null	1.00
Z1088:Dnah3	UTSW	7	120086297	missense	probably benign	0.00
Z1176:Dnah3	UTSW	7	119967803	missense
Z1177:Dnah3	UTSW	7	119967901	missense	probably damaging	0.99
Z1177:Dnah3	UTSW	7	120007862	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GACCCTAATGACTCCAGAGGAC -3'
(R):5'- GTCCACGTTCATGAACTCCTATG -3'

Sequencing Primer
(F):5'- CAGACAGAATTTGACTGCTTCTCAC -3'
(R):5'- AGTGGCCACCAAGAGTA -3'

Posted On

2014-08-25