Incidental Mutation 'R2015:Hcfc2'
ID222854
Institutional Source Beutler Lab
Gene Symbol Hcfc2
Ensembl Gene ENSMUSG00000020246
Gene Namehost cell factor C2
Synonyms1700129L13Rik
MMRRC Submission 040024-MU
Accession Numbers

Genbank: NM_001081218; MGI: 1915183

Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R2015 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location82696160-82742428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82738980 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 618 (N618D)
Ref Sequence ENSEMBL: ENSMUSP00000020478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020478] [ENSMUST00000160681]
Predicted Effect probably benign
Transcript: ENSMUST00000020478
AA Change: N618D

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020478
Gene: ENSMUSG00000020246
AA Change: N618D

DomainStartEndE-ValueType
Pfam:Kelch_1 22 60 2.1e-6 PFAM
Pfam:Kelch_5 68 106 1.1e-6 PFAM
Pfam:Kelch_3 81 135 8.8e-7 PFAM
Pfam:Kelch_5 186 230 8.4e-7 PFAM
Pfam:Kelch_3 206 253 1.6e-11 PFAM
Pfam:Kelch_1 244 302 7.5e-9 PFAM
Pfam:Kelch_3 254 323 3.4e-7 PFAM
Pfam:Kelch_5 312 356 1.4e-6 PFAM
FN3 357 591 8.43e-9 SMART
FN3 607 703 6.06e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160681
AA Change: N158D

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124489
Gene: ENSMUSG00000020246
AA Change: N158D

DomainStartEndE-ValueType
FN3 52 131 1.22e1 SMART
FN3 147 243 6.06e-1 SMART
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two proteins which interact with VP16, a herpes simplex virus protein that initiates virus infection. Both the encoded protein and the original Herpes host cell factor interact with VP16 through a beta-propeller domain. The original Herpes host cell factor, however, is effective at initiating viral infection while the encoded protein is not. Transcripts of varying length due to alternative polyadenylation signals have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null or severely hypomorphic allele exhibit reduced poly(I:C)-mediated TLR3 signaling and increased mortality following viral infection. [provided by MGI curators]
Allele List at MGI

none known

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C A 11: 101,987,218 H35Q probably damaging Het
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
Abca9 A T 11: 110,131,846 M1022K probably benign Het
Abhd4 T A 14: 54,262,832 H74Q probably damaging Het
Actg1 A G 11: 120,346,810 S49P possibly damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Aire T C 10: 78,042,958 D85G probably damaging Het
Akr1c18 T A 13: 4,145,309 D50V probably damaging Het
Ankrd13a C A 5: 114,792,109 A185E probably damaging Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Armc8 A T 9: 99,483,105 C661* probably null Het
Bbs10 C T 10: 111,300,855 Q610* probably null Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Bpifb9a T C 2: 154,268,200 probably null Het
Cdk14 T C 5: 5,380,082 K15R probably benign Het
Cdr1 A G X: 61,184,814 F249L probably benign Het
Cep250 A C 2: 155,981,453 H1009P probably damaging Het
Clasp2 A G 9: 113,911,500 T495A possibly damaging Het
Col19a1 C G 1: 24,559,753 G53A unknown Het
Cpne1 G A 2: 156,078,388 R166C probably damaging Het
Dtx3l G A 16: 35,936,427 H129Y probably benign Het
Ercc3 A G 18: 32,248,429 T433A probably benign Het
Gm9936 T A 5: 114,857,421 probably benign Het
Grina T C 15: 76,248,534 V167A probably damaging Het
Herpud1 T C 8: 94,392,206 V196A probably benign Het
Hist3h2a T A 11: 58,954,928 L64Q probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Igll1 A G 16: 16,863,775 S39P probably benign Het
Kdm5a T C 6: 120,431,990 S1545P probably benign Het
Klra8 C A 6: 130,115,573 C255F probably damaging Het
Krtap4-6 A T 11: 99,665,572 C110S unknown Het
Lef1 T A 3: 131,111,587 I39N probably damaging Het
Lnpep G A 17: 17,579,063 T110I probably damaging Het
Lrp1 T A 10: 127,540,694 T4282S probably benign Het
Lrp6 A G 6: 134,480,374 probably null Het
Ly6g5b A C 17: 35,114,678 S53A possibly damaging Het
M6pr T G 6: 122,313,373 N98K probably damaging Het
Mal2 T C 15: 54,600,740 *176Q probably null Het
Mansc1 T C 6: 134,610,311 D301G possibly damaging Het
March1 C A 8: 66,121,821 N11K probably damaging Het
Mast3 T A 8: 70,787,363 I338F probably benign Het
Mcm3 A G 1: 20,803,580 L772P probably damaging Het
Mib2 C T 4: 155,657,880 G176D probably damaging Het
Mier2 A T 10: 79,541,202 probably null Het
Mogs C T 6: 83,117,650 R483* probably null Het
Msl2 G T 9: 101,075,251 probably benign Het
Naa16 A T 14: 79,345,059 M530K probably damaging Het
Nde1 A T 16: 14,169,457 probably benign Het
Ndufb10 T C 17: 24,722,529 probably null Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Npffr2 T A 5: 89,582,892 I227N probably damaging Het
Nup210l T A 3: 90,185,432 L1231Q probably damaging Het
Olfr1355 T C 10: 78,879,388 I72T possibly damaging Het
Olfr453 A G 6: 42,744,850 E271G probably damaging Het
Pclo C A 5: 14,521,501 P300Q probably damaging Het
Pik3c2a T A 7: 116,350,931 probably null Het
Plekha5 T A 6: 140,534,564 probably null Het
Pls1 A G 9: 95,761,365 V527A possibly damaging Het
Ppfia2 T C 10: 106,474,677 M15T probably benign Het
Prkd2 T A 7: 16,847,677 C152* probably null Het
Ptprq T G 10: 107,667,422 K792Q probably damaging Het
Rbbp8 T C 18: 11,720,624 M296T probably benign Het
Rfc3 T C 5: 151,647,538 probably null Het
Rnf17 A G 14: 56,486,969 N1090S probably benign Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Sdsl G A 5: 120,463,153 T18M probably damaging Het
Sepsecs T A 5: 52,647,624 Q365L probably benign Het
Sgta A T 10: 81,051,296 V45E probably damaging Het
Slc25a46 A T 18: 31,609,725 H29Q probably benign Het
Slc2a8 A C 2: 32,981,380 V136G probably benign Het
Smg7 A T 1: 152,860,508 N166K probably damaging Het
Spata21 C T 4: 141,107,329 Q505* probably null Het
Strn4 T C 7: 16,833,028 S458P possibly damaging Het
Tbc1d22a C T 15: 86,299,684 T248M probably damaging Het
Trabd T A 15: 89,084,726 M149K possibly damaging Het
Trpv3 A T 11: 73,279,827 N178Y probably damaging Het
Try5 C T 6: 41,314,651 probably null Het
Tsg101 C T 7: 46,908,904 probably null Het
Ube3b A G 5: 114,411,149 E738G probably damaging Het
Unc13d A G 11: 116,068,755 S631P probably damaging Het
Unc5d T C 8: 28,758,979 T297A probably damaging Het
Usp18 A T 6: 121,268,550 E1V probably damaging Het
Vapb C A 2: 173,771,598 P97T probably benign Het
Vmn1r33 T A 6: 66,612,372 D66V probably benign Het
Vmn2r19 T A 6: 123,315,995 M332K probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vwde C A 6: 13,208,338 G182C possibly damaging Het
Wdfy3 A C 5: 101,860,486 S2778A probably null Het
Zbtb2 T A 10: 4,369,757 I90F possibly damaging Het
Zfp518b C A 5: 38,672,002 V887F probably benign Het
Zfp790 A G 7: 29,828,861 T324A probably benign Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Hcfc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Hcfc2 APN 10 82741278 splice site probably null
IGL01799:Hcfc2 APN 10 82700991 missense probably damaging 1.00
IGL01916:Hcfc2 APN 10 82734383 missense possibly damaging 0.94
IGL02150:Hcfc2 APN 10 82710018 missense probably damaging 1.00
IGL02378:Hcfc2 APN 10 82709071 missense possibly damaging 0.64
IGL02580:Hcfc2 APN 10 82728422 missense probably benign 0.00
IGL02641:Hcfc2 APN 10 82702549 missense probably damaging 1.00
Backstabbing UTSW 10 82711825 splice site probably null
feckless UTSW 10 82712061 missense probably damaging 1.00
Minions UTSW 10 82739245 missense probably damaging 1.00
scaffold UTSW 10 82738408 missense probably damaging 1.00
R0380:Hcfc2 UTSW 10 82728438 splice site probably benign
R0528:Hcfc2 UTSW 10 82739245 missense probably damaging 1.00
R0534:Hcfc2 UTSW 10 82738408 missense probably damaging 1.00
R1646:Hcfc2 UTSW 10 82701027 missense probably damaging 1.00
R1903:Hcfc2 UTSW 10 82702558 missense probably damaging 0.98
R1939:Hcfc2 UTSW 10 82702450 missense probably damaging 0.99
R2014:Hcfc2 UTSW 10 82738980 missense probably benign 0.23
R2571:Hcfc2 UTSW 10 82709023 missense probably damaging 1.00
R4540:Hcfc2 UTSW 10 82732647 missense probably benign 0.10
R4694:Hcfc2 UTSW 10 82723700 missense probably damaging 1.00
R4735:Hcfc2 UTSW 10 82712080 missense probably damaging 1.00
R4833:Hcfc2 UTSW 10 82709146 missense probably null 0.01
R6837:Hcfc2 UTSW 10 82739196 missense probably damaging 0.96
R7268:Hcfc2 UTSW 10 82709012 nonsense probably null
R7683:Hcfc2 UTSW 10 82699229 missense probably benign 0.00
R7733:Hcfc2 UTSW 10 82739179 missense probably benign 0.00
R7742:Hcfc2 UTSW 10 82711825 splice site probably null
V3553:Hcfc2 UTSW 10 82712061 missense probably damaging 1.00
X0022:Hcfc2 UTSW 10 82709967 missense probably damaging 0.99
Z1176:Hcfc2 UTSW 10 82699172 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCTTTGGGGATATGATAGGAAGC -3'
(R):5'- TCTGAACACAATGGCGGGTC -3'

Sequencing Primer
(F):5'- GGAAGCTTGGGTATTTAAACTGTAC -3'
(R):5'- CATTTGCAAGCTGCCCAG -3'
Posted On2014-08-25