Mutagenetix > Incidental Mutation

Incidental Mutation 'R2015:Hcfc2'

222854

Institutional Source

Beutler Lab

Gene Symbol

Hcfc2

Ensembl Gene

ENSMUSG00000020246

Gene Name

host cell factor C2

Synonyms

1700129L13Rik

MMRRC Submission

040024-MU

Accession Numbers

Genbank: NM_001081218; MGI: 1915183

Essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R2015 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82696160-82742428 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 82738980 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 618 (N618D)

Ref Sequence

ENSEMBL: ENSMUSP00000020478 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020478] [ENSMUST00000160681]

AlphaFold

Q9D968

Predicted Effect

probably benign
Transcript: ENSMUST00000020478
AA Change: N618D

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000020478
Gene: ENSMUSG00000020246
AA Change: N618D

Domain	Start	End	E-Value	Type
Pfam:Kelch_1	22	60	2.1e-6	PFAM
Pfam:Kelch_5	68	106	1.1e-6	PFAM
Pfam:Kelch_3	81	135	8.8e-7	PFAM
Pfam:Kelch_5	186	230	8.4e-7	PFAM
Pfam:Kelch_3	206	253	1.6e-11	PFAM
Pfam:Kelch_1	244	302	7.5e-9	PFAM
Pfam:Kelch_3	254	323	3.4e-7	PFAM
Pfam:Kelch_5	312	356	1.4e-6	PFAM
FN3	357	591	8.43e-9	SMART
FN3	607	703	6.06e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160681
AA Change: N158D

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000124489
Gene: ENSMUSG00000020246
AA Change: N158D

Domain	Start	End	E-Value	Type
FN3	52	131	1.22e1	SMART
FN3	147	243	6.06e-1	SMART

Meta Mutation Damage Score

0.0608

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two proteins which interact with VP16, a herpes simplex virus protein that initiates virus infection. Both the encoded protein and the original Herpes host cell factor interact with VP16 through a beta-propeller domain. The original Herpes host cell factor, however, is effective at initiating viral infection while the encoded protein is not. Transcripts of varying length due to alternative polyadenylation signals have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null or severely hypomorphic allele exhibit reduced poly(I:C)-mediated TLR3 signaling and increased mortality following viral infection. [provided by MGI curators]

Allele List at MGI

none known

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	C	A	11: 101,987,218	H35Q	probably damaging	Het
1700015F17Rik	T	A	5: 5,455,964	I106L	probably benign	Het
Abca9	A	T	11: 110,131,846	M1022K	probably benign	Het
Abhd4	T	A	14: 54,262,832	H74Q	probably damaging	Het
Actg1	A	G	11: 120,346,810	S49P	possibly damaging	Het
Adcy8	C	T	15: 64,767,878	G678S	probably benign	Het
Aire	T	C	10: 78,042,958	D85G	probably damaging	Het
Akr1c18	T	A	13: 4,145,309	D50V	probably damaging	Het
Ankrd13a	C	A	5: 114,792,109	A185E	probably damaging	Het
Apc	A	G	18: 34,315,591	I1813V	probably damaging	Het
Armc8	A	T	9: 99,483,105	C661*	probably null	Het
Bbs10	C	T	10: 111,300,855	Q610*	probably null	Het
Blm	T	C	7: 80,502,399	E600G	probably damaging	Het
Bpifb9a	T	C	2: 154,268,200		probably null	Het
Cdk14	T	C	5: 5,380,082	K15R	probably benign	Het
Cdr1	A	G	X: 61,184,814	F249L	probably benign	Het
Cep250	A	C	2: 155,981,453	H1009P	probably damaging	Het
Clasp2	A	G	9: 113,911,500	T495A	possibly damaging	Het
Col19a1	C	G	1: 24,559,753	G53A	unknown	Het
Cpne1	G	A	2: 156,078,388	R166C	probably damaging	Het
Dtx3l	G	A	16: 35,936,427	H129Y	probably benign	Het
Ercc3	A	G	18: 32,248,429	T433A	probably benign	Het
Gm9936	T	A	5: 114,857,421		probably benign	Het
Grina	T	C	15: 76,248,534	V167A	probably damaging	Het
Herpud1	T	C	8: 94,392,206	V196A	probably benign	Het
Hist3h2a	T	A	11: 58,954,928	L64Q	probably damaging	Het
Hlcs	A	G	16: 94,262,740	V487A	probably benign	Het
Hspa9	A	T	18: 34,946,648	Y243N	probably damaging	Het
Igll1	A	G	16: 16,863,775	S39P	probably benign	Het
Kdm5a	T	C	6: 120,431,990	S1545P	probably benign	Het
Klra8	C	A	6: 130,115,573	C255F	probably damaging	Het
Krtap4-6	A	T	11: 99,665,572	C110S	unknown	Het
Lef1	T	A	3: 131,111,587	I39N	probably damaging	Het
Lnpep	G	A	17: 17,579,063	T110I	probably damaging	Het
Lrp1	T	A	10: 127,540,694	T4282S	probably benign	Het
Lrp6	A	G	6: 134,480,374		probably null	Het
Ly6g5b	A	C	17: 35,114,678	S53A	possibly damaging	Het
M6pr	T	G	6: 122,313,373	N98K	probably damaging	Het
Mal2	T	C	15: 54,600,740	*176Q	probably null	Het
Mansc1	T	C	6: 134,610,311	D301G	possibly damaging	Het
March1	C	A	8: 66,121,821	N11K	probably damaging	Het
Mast3	T	A	8: 70,787,363	I338F	probably benign	Het
Mcm3	A	G	1: 20,803,580	L772P	probably damaging	Het
Mib2	C	T	4: 155,657,880	G176D	probably damaging	Het
Mier2	A	T	10: 79,541,202		probably null	Het
Mogs	C	T	6: 83,117,650	R483*	probably null	Het
Msl2	G	T	9: 101,075,251		probably benign	Het
Naa16	A	T	14: 79,345,059	M530K	probably damaging	Het
Nde1	A	T	16: 14,169,457		probably benign	Het
Ndufb10	T	C	17: 24,722,529		probably null	Het
Nhsl1	A	T	10: 18,511,592	R205W	probably damaging	Het
Npffr2	T	A	5: 89,582,892	I227N	probably damaging	Het
Nup210l	T	A	3: 90,185,432	L1231Q	probably damaging	Het
Olfr1355	T	C	10: 78,879,388	I72T	possibly damaging	Het
Olfr453	A	G	6: 42,744,850	E271G	probably damaging	Het
Pclo	C	A	5: 14,521,501	P300Q	probably damaging	Het
Pik3c2a	T	A	7: 116,350,931		probably null	Het
Plekha5	T	A	6: 140,534,564		probably null	Het
Pls1	A	G	9: 95,761,365	V527A	possibly damaging	Het
Ppfia2	T	C	10: 106,474,677	M15T	probably benign	Het
Prkd2	T	A	7: 16,847,677	C152*	probably null	Het
Ptprq	T	G	10: 107,667,422	K792Q	probably damaging	Het
Rbbp8	T	C	18: 11,720,624	M296T	probably benign	Het
Rfc3	T	C	5: 151,647,538		probably null	Het
Rnf17	A	G	14: 56,486,969	N1090S	probably benign	Het
Sash1	A	T	10: 8,729,413	V1071D	probably benign	Het
Sdsl	G	A	5: 120,463,153	T18M	probably damaging	Het
Sepsecs	T	A	5: 52,647,624	Q365L	probably benign	Het
Sgta	A	T	10: 81,051,296	V45E	probably damaging	Het
Slc25a46	A	T	18: 31,609,725	H29Q	probably benign	Het
Slc2a8	A	C	2: 32,981,380	V136G	probably benign	Het
Smg7	A	T	1: 152,860,508	N166K	probably damaging	Het
Spata21	C	T	4: 141,107,329	Q505*	probably null	Het
Strn4	T	C	7: 16,833,028	S458P	possibly damaging	Het
Tbc1d22a	C	T	15: 86,299,684	T248M	probably damaging	Het
Trabd	T	A	15: 89,084,726	M149K	possibly damaging	Het
Trpv3	A	T	11: 73,279,827	N178Y	probably damaging	Het
Try5	C	T	6: 41,314,651		probably null	Het
Tsg101	C	T	7: 46,908,904		probably null	Het
Ube3b	A	G	5: 114,411,149	E738G	probably damaging	Het
Unc13d	A	G	11: 116,068,755	S631P	probably damaging	Het
Unc5d	T	C	8: 28,758,979	T297A	probably damaging	Het
Usp18	A	T	6: 121,268,550	E1V	probably damaging	Het
Vapb	C	A	2: 173,771,598	P97T	probably benign	Het
Vmn1r33	T	A	6: 66,612,372	D66V	probably benign	Het
Vmn2r19	T	A	6: 123,315,995	M332K	probably benign	Het
Vmn2r71	T	A	7: 85,620,637	M452K	probably benign	Het
Vps13b	T	C	15: 35,607,142	S1074P	probably damaging	Het
Vwde	C	A	6: 13,208,338	G182C	possibly damaging	Het
Wdfy3	A	C	5: 101,860,486	S2778A	probably null	Het
Zbtb2	T	A	10: 4,369,757	I90F	possibly damaging	Het
Zfp518b	C	A	5: 38,672,002	V887F	probably benign	Het
Zfp790	A	G	7: 29,828,861	T324A	probably benign	Het
Zufsp	A	G	10: 33,929,824	V437A	possibly damaging	Het

Other mutations in Hcfc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00847:Hcfc2	APN	10	82741278	splice site	probably null
IGL01799:Hcfc2	APN	10	82700991	missense	probably damaging	1.00
IGL01916:Hcfc2	APN	10	82734383	missense	possibly damaging	0.94
IGL02150:Hcfc2	APN	10	82710018	missense	probably damaging	1.00
IGL02378:Hcfc2	APN	10	82709071	missense	possibly damaging	0.64
IGL02580:Hcfc2	APN	10	82728422	missense	probably benign	0.00
IGL02641:Hcfc2	APN	10	82702549	missense	probably damaging	1.00
Backstabbing	UTSW	10	82711825	splice site	probably null
feckless	UTSW	10	82712061	missense	probably damaging	1.00
Minions	UTSW	10	82739245	missense	probably damaging	1.00
scaffold	UTSW	10	82738408	missense	probably damaging	1.00
R0380:Hcfc2	UTSW	10	82728438	splice site	probably benign
R0528:Hcfc2	UTSW	10	82739245	missense	probably damaging	1.00
R0534:Hcfc2	UTSW	10	82738408	missense	probably damaging	1.00
R1646:Hcfc2	UTSW	10	82701027	missense	probably damaging	1.00
R1903:Hcfc2	UTSW	10	82702558	missense	probably damaging	0.98
R1939:Hcfc2	UTSW	10	82702450	missense	probably damaging	0.99
R2014:Hcfc2	UTSW	10	82738980	missense	probably benign	0.23
R2571:Hcfc2	UTSW	10	82709023	missense	probably damaging	1.00
R4540:Hcfc2	UTSW	10	82732647	missense	probably benign	0.10
R4694:Hcfc2	UTSW	10	82723700	missense	probably damaging	1.00
R4735:Hcfc2	UTSW	10	82712080	missense	probably damaging	1.00
R4833:Hcfc2	UTSW	10	82709146	missense	probably null	0.01
R6837:Hcfc2	UTSW	10	82739196	missense	probably damaging	0.96
R7268:Hcfc2	UTSW	10	82709012	nonsense	probably null
R7683:Hcfc2	UTSW	10	82699229	missense	probably benign	0.00
R7733:Hcfc2	UTSW	10	82739179	missense	probably benign	0.00
R7742:Hcfc2	UTSW	10	82711825	splice site	probably null
R8319:Hcfc2	UTSW	10	82738367	missense	probably damaging	0.98
R8829:Hcfc2	UTSW	10	82738345	missense	probably damaging	1.00
R8989:Hcfc2	UTSW	10	82700988	missense	probably damaging	1.00
R9189:Hcfc2	UTSW	10	82699207	missense	probably benign	0.06
R9241:Hcfc2	UTSW	10	82732651	missense	probably benign
R9362:Hcfc2	UTSW	10	82738424	missense	probably damaging	1.00
R9363:Hcfc2	UTSW	10	82738424	missense	probably damaging	1.00
R9386:Hcfc2	UTSW	10	82739103	missense	probably damaging	1.00
R9701:Hcfc2	UTSW	10	82738435	nonsense	probably null
R9802:Hcfc2	UTSW	10	82738435	nonsense	probably null
V3553:Hcfc2	UTSW	10	82712061	missense	probably damaging	1.00
X0022:Hcfc2	UTSW	10	82709967	missense	probably damaging	0.99
Z1176:Hcfc2	UTSW	10	82699172	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CCTTTGGGGATATGATAGGAAGC -3'
(R):5'- TCTGAACACAATGGCGGGTC -3'

Sequencing Primer
(F):5'- GGAAGCTTGGGTATTTAAACTGTAC -3'
(R):5'- CATTTGCAAGCTGCCCAG -3'

Posted On

2014-08-25