Incidental Mutation 'R2015:Ptprq'
ID222858
Institutional Source Beutler Lab
Gene Symbol Ptprq
Ensembl Gene ENSMUSG00000035916
Gene Nameprotein tyrosine phosphatase, receptor type, Q
Synonyms
MMRRC Submission 040024-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock #R2015 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location107517049-107720051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 107667422 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 792 (K792Q)
Ref Sequence ENSEMBL: ENSMUSP00000058572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050702]
Predicted Effect probably damaging
Transcript: ENSMUST00000050702
AA Change: K792Q

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916
AA Change: K792Q

DomainStartEndE-ValueType
FN3 57 141 3.17e-13 SMART
FN3 156 294 1.55e-7 SMART
FN3 307 384 4.45e-8 SMART
FN3 398 555 1.17e-7 SMART
FN3 569 648 7.06e-11 SMART
FN3 666 743 7.68e-12 SMART
FN3 760 839 1.88e-6 SMART
FN3 855 932 1.33e-6 SMART
FN3 949 1037 2.31e-6 SMART
FN3 1054 1135 1.24e-6 SMART
FN3 1151 1229 2.39e-8 SMART
FN3 1244 1325 6.29e-8 SMART
FN3 1341 1416 2.87e-11 SMART
FN3 1431 1524 2.82e-10 SMART
FN3 1540 1622 6.35e-4 SMART
FN3 1642 1732 7.93e-5 SMART
transmembrane domain 1907 1929 N/A INTRINSIC
PTPc 2003 2262 1.14e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218399
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C A 11: 101,987,218 H35Q probably damaging Het
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
Abca9 A T 11: 110,131,846 M1022K probably benign Het
Abhd4 T A 14: 54,262,832 H74Q probably damaging Het
Actg1 A G 11: 120,346,810 S49P possibly damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Aire T C 10: 78,042,958 D85G probably damaging Het
Akr1c18 T A 13: 4,145,309 D50V probably damaging Het
Ankrd13a C A 5: 114,792,109 A185E probably damaging Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Armc8 A T 9: 99,483,105 C661* probably null Het
Bbs10 C T 10: 111,300,855 Q610* probably null Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Bpifb9a T C 2: 154,268,200 probably null Het
Cdk14 T C 5: 5,380,082 K15R probably benign Het
Cdr1 A G X: 61,184,814 F249L probably benign Het
Cep250 A C 2: 155,981,453 H1009P probably damaging Het
Clasp2 A G 9: 113,911,500 T495A possibly damaging Het
Col19a1 C G 1: 24,559,753 G53A unknown Het
Cpne1 G A 2: 156,078,388 R166C probably damaging Het
Dtx3l G A 16: 35,936,427 H129Y probably benign Het
Ercc3 A G 18: 32,248,429 T433A probably benign Het
Gm9936 T A 5: 114,857,421 probably benign Het
Grina T C 15: 76,248,534 V167A probably damaging Het
Hcfc2 A G 10: 82,738,980 N618D probably benign Het
Herpud1 T C 8: 94,392,206 V196A probably benign Het
Hist3h2a T A 11: 58,954,928 L64Q probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Igll1 A G 16: 16,863,775 S39P probably benign Het
Kdm5a T C 6: 120,431,990 S1545P probably benign Het
Klra8 C A 6: 130,115,573 C255F probably damaging Het
Krtap4-6 A T 11: 99,665,572 C110S unknown Het
Lef1 T A 3: 131,111,587 I39N probably damaging Het
Lnpep G A 17: 17,579,063 T110I probably damaging Het
Lrp1 T A 10: 127,540,694 T4282S probably benign Het
Lrp6 A G 6: 134,480,374 probably null Het
Ly6g5b A C 17: 35,114,678 S53A possibly damaging Het
M6pr T G 6: 122,313,373 N98K probably damaging Het
Mal2 T C 15: 54,600,740 *176Q probably null Het
Mansc1 T C 6: 134,610,311 D301G possibly damaging Het
March1 C A 8: 66,121,821 N11K probably damaging Het
Mast3 T A 8: 70,787,363 I338F probably benign Het
Mcm3 A G 1: 20,803,580 L772P probably damaging Het
Mib2 C T 4: 155,657,880 G176D probably damaging Het
Mier2 A T 10: 79,541,202 probably null Het
Mogs C T 6: 83,117,650 R483* probably null Het
Msl2 G T 9: 101,075,251 probably benign Het
Naa16 A T 14: 79,345,059 M530K probably damaging Het
Nde1 A T 16: 14,169,457 probably benign Het
Ndufb10 T C 17: 24,722,529 probably null Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Npffr2 T A 5: 89,582,892 I227N probably damaging Het
Nup210l T A 3: 90,185,432 L1231Q probably damaging Het
Olfr1355 T C 10: 78,879,388 I72T possibly damaging Het
Olfr453 A G 6: 42,744,850 E271G probably damaging Het
Pclo C A 5: 14,521,501 P300Q probably damaging Het
Pik3c2a T A 7: 116,350,931 probably null Het
Plekha5 T A 6: 140,534,564 probably null Het
Pls1 A G 9: 95,761,365 V527A possibly damaging Het
Ppfia2 T C 10: 106,474,677 M15T probably benign Het
Prkd2 T A 7: 16,847,677 C152* probably null Het
Rbbp8 T C 18: 11,720,624 M296T probably benign Het
Rfc3 T C 5: 151,647,538 probably null Het
Rnf17 A G 14: 56,486,969 N1090S probably benign Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Sdsl G A 5: 120,463,153 T18M probably damaging Het
Sepsecs T A 5: 52,647,624 Q365L probably benign Het
Sgta A T 10: 81,051,296 V45E probably damaging Het
Slc25a46 A T 18: 31,609,725 H29Q probably benign Het
Slc2a8 A C 2: 32,981,380 V136G probably benign Het
Smg7 A T 1: 152,860,508 N166K probably damaging Het
Spata21 C T 4: 141,107,329 Q505* probably null Het
Strn4 T C 7: 16,833,028 S458P possibly damaging Het
Tbc1d22a C T 15: 86,299,684 T248M probably damaging Het
Trabd T A 15: 89,084,726 M149K possibly damaging Het
Trpv3 A T 11: 73,279,827 N178Y probably damaging Het
Try5 C T 6: 41,314,651 probably null Het
Tsg101 C T 7: 46,908,904 probably null Het
Ube3b A G 5: 114,411,149 E738G probably damaging Het
Unc13d A G 11: 116,068,755 S631P probably damaging Het
Unc5d T C 8: 28,758,979 T297A probably damaging Het
Usp18 A T 6: 121,268,550 E1V probably damaging Het
Vapb C A 2: 173,771,598 P97T probably benign Het
Vmn1r33 T A 6: 66,612,372 D66V probably benign Het
Vmn2r19 T A 6: 123,315,995 M332K probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vwde C A 6: 13,208,338 G182C possibly damaging Het
Wdfy3 A C 5: 101,860,486 S2778A probably null Het
Zbtb2 T A 10: 4,369,757 I90F possibly damaging Het
Zfp518b C A 5: 38,672,002 V887F probably benign Het
Zfp790 A G 7: 29,828,861 T324A probably benign Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Ptprq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptprq APN 10 107576929 missense probably damaging 0.98
IGL00537:Ptprq APN 10 107710522 missense probably benign 0.07
IGL00547:Ptprq APN 10 107718541 missense probably damaging 0.99
IGL00586:Ptprq APN 10 107608122 splice site probably benign
IGL00648:Ptprq APN 10 107646716 missense probably benign 0.10
IGL01123:Ptprq APN 10 107686218 missense probably damaging 0.96
IGL01343:Ptprq APN 10 107638839 missense probably damaging 0.96
IGL01348:Ptprq APN 10 107711904 missense probably damaging 1.00
IGL01433:Ptprq APN 10 107576880 missense probably damaging 0.99
IGL01510:Ptprq APN 10 107712048 missense probably damaging 1.00
IGL01535:Ptprq APN 10 107699596 missense probably benign
IGL01631:Ptprq APN 10 107643538 missense probably benign 0.00
IGL01633:Ptprq APN 10 107699723 splice site probably benign
IGL01702:Ptprq APN 10 107517866 missense probably benign 0.00
IGL01733:Ptprq APN 10 107662599 missense probably benign 0.10
IGL01806:Ptprq APN 10 107699608 missense probably damaging 1.00
IGL01832:Ptprq APN 10 107565839 critical splice donor site probably null
IGL01961:Ptprq APN 10 107643654 missense probably damaging 1.00
IGL02108:Ptprq APN 10 107646617 missense probably damaging 1.00
IGL02120:Ptprq APN 10 107667472 missense probably damaging 1.00
IGL02160:Ptprq APN 10 107653565 missense probably benign 0.00
IGL02178:Ptprq APN 10 107686319 missense probably benign 0.03
IGL02249:Ptprq APN 10 107582359 missense probably damaging 1.00
IGL02267:Ptprq APN 10 107646558 missense probably damaging 1.00
IGL02527:Ptprq APN 10 107686563 missense probably benign 0.04
IGL02529:Ptprq APN 10 107635365 missense probably benign 0.03
IGL02542:Ptprq APN 10 107662555 missense probably damaging 1.00
IGL02582:Ptprq APN 10 107643999 missense probably benign 0.00
IGL02708:Ptprq APN 10 107652700 missense probably damaging 1.00
IGL02894:Ptprq APN 10 107667424 missense probably benign
IGL02903:Ptprq APN 10 107666586 missense possibly damaging 0.51
IGL02951:Ptprq APN 10 107667460 missense probably benign 0.03
IGL02982:Ptprq APN 10 107586684 missense probably damaging 1.00
IGL03000:Ptprq APN 10 107542657 missense probably damaging 1.00
IGL03024:Ptprq APN 10 107685566 missense possibly damaging 0.69
IGL03240:Ptprq APN 10 107688507 missense probably benign
P0043:Ptprq UTSW 10 107580225 missense probably benign 0.03
PIT4812001:Ptprq UTSW 10 107666567 missense probably damaging 1.00
R0200:Ptprq UTSW 10 107685157 missense probably benign
R0268:Ptprq UTSW 10 107705548 missense probably benign
R0276:Ptprq UTSW 10 107542735 critical splice acceptor site probably null
R0279:Ptprq UTSW 10 107608417 missense probably damaging 0.96
R0335:Ptprq UTSW 10 107708728 missense probably benign
R0344:Ptprq UTSW 10 107705582 missense probably benign
R0357:Ptprq UTSW 10 107686199 splice site probably benign
R0454:Ptprq UTSW 10 107582530 nonsense probably null
R0479:Ptprq UTSW 10 107643994 nonsense probably null
R0491:Ptprq UTSW 10 107608175 missense probably damaging 0.98
R0519:Ptprq UTSW 10 107538920 splice site probably benign
R0523:Ptprq UTSW 10 107580220 missense possibly damaging 0.54
R0553:Ptprq UTSW 10 107710627 missense probably benign 0.33
R0746:Ptprq UTSW 10 107517831 missense probably damaging 1.00
R0755:Ptprq UTSW 10 107582539 missense probably benign 0.09
R1434:Ptprq UTSW 10 107586714 missense probably damaging 1.00
R1445:Ptprq UTSW 10 107662562 missense probably damaging 1.00
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1558:Ptprq UTSW 10 107644043 missense probably damaging 1.00
R1567:Ptprq UTSW 10 107565887 missense probably benign 0.13
R1711:Ptprq UTSW 10 107534699 nonsense probably null
R1720:Ptprq UTSW 10 107686294 missense probably damaging 1.00
R1746:Ptprq UTSW 10 107638830 missense probably damaging 1.00
R1776:Ptprq UTSW 10 107685089 missense probably damaging 1.00
R1822:Ptprq UTSW 10 107718478 missense probably damaging 1.00
R1872:Ptprq UTSW 10 107643999 missense probably benign 0.19
R1944:Ptprq UTSW 10 107582388 missense probably benign 0.23
R1945:Ptprq UTSW 10 107582388 missense probably benign 0.23
R2006:Ptprq UTSW 10 107666546 missense probably damaging 1.00
R2014:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2097:Ptprq UTSW 10 107653493 missense probably benign 0.05
R2172:Ptprq UTSW 10 107590994 nonsense probably null
R2174:Ptprq UTSW 10 107705553 missense probably damaging 1.00
R2248:Ptprq UTSW 10 107643070 splice site probably null
R2404:Ptprq UTSW 10 107686599 missense probably damaging 1.00
R3423:Ptprq UTSW 10 107582476 missense probably damaging 0.99
R3683:Ptprq UTSW 10 107708628 missense probably benign 0.01
R3875:Ptprq UTSW 10 107685104 missense possibly damaging 0.88
R3945:Ptprq UTSW 10 107686392 splice site probably benign
R3946:Ptprq UTSW 10 107686392 splice site probably benign
R3974:Ptprq UTSW 10 107712062 missense possibly damaging 0.88
R3982:Ptprq UTSW 10 107543396 missense probably damaging 0.99
R4105:Ptprq UTSW 10 107572967 missense probably damaging 1.00
R4118:Ptprq UTSW 10 107711920 missense probably benign 0.37
R4175:Ptprq UTSW 10 107711917 missense probably benign
R4231:Ptprq UTSW 10 107686283 nonsense probably null
R4356:Ptprq UTSW 10 107608364 missense probably damaging 0.99
R4435:Ptprq UTSW 10 107685055 missense possibly damaging 0.89
R4678:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4679:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4745:Ptprq UTSW 10 107524253 missense probably damaging 1.00
R4771:Ptprq UTSW 10 107688427 missense probably benign
R4778:Ptprq UTSW 10 107591022 missense probably benign 0.15
R4808:Ptprq UTSW 10 107718507 missense probably damaging 1.00
R4809:Ptprq UTSW 10 107563175 missense probably damaging 1.00
R4818:Ptprq UTSW 10 107710581 missense possibly damaging 0.86
R4845:Ptprq UTSW 10 107653532 missense probably benign 0.00
R4901:Ptprq UTSW 10 107688414 missense probably benign 0.01
R4942:Ptprq UTSW 10 107688429 missense probably benign 0.01
R4946:Ptprq UTSW 10 107525734 missense probably benign
R4959:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R4973:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R5007:Ptprq UTSW 10 107608276 missense probably benign 0.00
R5053:Ptprq UTSW 10 107563202 missense probably damaging 1.00
R5055:Ptprq UTSW 10 107534679 missense probably benign 0.37
R5090:Ptprq UTSW 10 107526089 missense probably damaging 1.00
R5158:Ptprq UTSW 10 107534704 missense probably damaging 1.00
R5163:Ptprq UTSW 10 107524331 missense probably damaging 1.00
R5222:Ptprq UTSW 10 107662564 missense probably damaging 0.96
R5244:Ptprq UTSW 10 107586695 missense possibly damaging 0.62
R5249:Ptprq UTSW 10 107699635 missense probably damaging 0.99
R5503:Ptprq UTSW 10 107688328 splice site probably null
R5508:Ptprq UTSW 10 107686231 missense probably benign 0.00
R5601:Ptprq UTSW 10 107608430 missense probably benign
R5722:Ptprq UTSW 10 107686365 missense possibly damaging 0.72
R5819:Ptprq UTSW 10 107719883 start gained probably benign
R5862:Ptprq UTSW 10 107565878 missense probably benign 0.02
R5891:Ptprq UTSW 10 107576895 missense possibly damaging 0.94
R5916:Ptprq UTSW 10 107523513 missense probably damaging 1.00
R6054:Ptprq UTSW 10 107582358 missense probably damaging 1.00
R6058:Ptprq UTSW 10 107635274 missense probably benign 0.00
R6075:Ptprq UTSW 10 107525760 missense probably damaging 1.00
R6101:Ptprq UTSW 10 107580266 missense possibly damaging 0.93
R6189:Ptprq UTSW 10 107517887 missense probably damaging 1.00
R6235:Ptprq UTSW 10 107635338 missense possibly damaging 0.61
R6351:Ptprq UTSW 10 107708668 missense probably damaging 0.99
R6394:Ptprq UTSW 10 107642943 nonsense probably null
R6449:Ptprq UTSW 10 107705583 missense probably benign 0.00
R6526:Ptprq UTSW 10 107542653 nonsense probably null
R6544:Ptprq UTSW 10 107608241 missense probably damaging 1.00
R6609:Ptprq UTSW 10 107572968 missense probably damaging 0.99
R6862:Ptprq UTSW 10 107686225 missense probably damaging 0.96
R6874:Ptprq UTSW 10 107718599 missense possibly damaging 0.80
R6892:Ptprq UTSW 10 107576004 missense probably benign 0.00
R7082:Ptprq UTSW 10 107708730 missense probably benign 0.10
R7210:Ptprq UTSW 10 107685171 missense probably damaging 1.00
R7253:Ptprq UTSW 10 107608273 missense probably benign 0.30
R7293:Ptprq UTSW 10 107635506 nonsense probably null
R7445:Ptprq UTSW 10 107590959 missense probably damaging 1.00
R7632:Ptprq UTSW 10 107711922 missense probably benign 0.32
R7685:Ptprq UTSW 10 107643978 missense probably damaging 1.00
R7703:Ptprq UTSW 10 107644146 missense probably benign 0.01
R7774:Ptprq UTSW 10 107643669 missense probably damaging 0.96
R7897:Ptprq UTSW 10 107710623 missense probably benign 0.21
R8023:Ptprq UTSW 10 107652616 nonsense probably null
R8071:Ptprq UTSW 10 107644035 missense possibly damaging 0.62
R8084:Ptprq UTSW 10 107608433 missense probably benign
R8086:Ptprq UTSW 10 107646639 nonsense probably null
R8169:Ptprq UTSW 10 107582490 missense probably damaging 1.00
R8223:Ptprq UTSW 10 107699638 missense probably benign 0.00
R8235:Ptprq UTSW 10 107582541 missense probably damaging 1.00
R8235:Ptprq UTSW 10 107705490 missense probably benign 0.32
R8278:Ptprq UTSW 10 107686378 missense possibly damaging 0.87
Z1088:Ptprq UTSW 10 107699672 missense possibly damaging 0.56
Z1176:Ptprq UTSW 10 107526070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAACACCCCTTCTCGTATGAG -3'
(R):5'- AGCACACTGTCATTCTTTGTG -3'

Sequencing Primer
(F):5'- ACACCCCTTCTCGTATGAGTATAAG -3'
(R):5'- GCACACTGTCATTCTTTGTGTAATG -3'
Posted On2014-08-25