Incidental Mutation 'R2015:Bbs10'
ID222860
Institutional Source Beutler Lab
Gene Symbol Bbs10
Ensembl Gene ENSMUSG00000035759
Gene NameBardet-Biedl syndrome 10 (human)
Synonyms
MMRRC Submission 040024-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2015 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location111298679-111301727 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 111300855 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 610 (Q610*)
Ref Sequence ENSEMBL: ENSMUSP00000049387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040454] [ENSMUST00000105275]
Predicted Effect probably null
Transcript: ENSMUST00000040454
AA Change: Q610*
SMART Domains Protein: ENSMUSP00000049387
Gene: ENSMUSG00000035759
AA Change: Q610*

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 17 103 3.6e-15 PFAM
Pfam:Cpn60_TCP1 139 427 1.1e-7 PFAM
SCOP:d1a6da1 567 695 3e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105275
SMART Domains Protein: ENSMUSP00000100911
Gene: ENSMUSG00000020189

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
coiled coil region 113 144 N/A INTRINSIC
PH 149 267 3.65e-16 SMART
Pfam:Oxysterol_BP 406 752 4.6e-91 PFAM
coiled coil region 831 853 N/A INTRINSIC
transmembrane domain 871 888 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219990
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by progressive retinal degeneration, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse and the similar phenotypes exhibited by mutations in BBS gene family members is likely due to their shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene is likely not a ciliary protein but rather has distant sequence homology to type II chaperonins. As a molecular chaperone, this protein may affect the folding or stability of other ciliary or basal body proteins. Inhibition of this protein's expression impairs ciliogenesis in preadipocytes. Mutations in this gene cause Bardet-Biedl syndrome type 10. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop obesity, hyperleptinemia, retinal degeneration, structural defects in renal glomeruli, microalbuminuria, polyuria, increased circulating antidiuretic hormone levels, and vacuolated renal epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C A 11: 101,987,218 H35Q probably damaging Het
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
Abca9 A T 11: 110,131,846 M1022K probably benign Het
Abhd4 T A 14: 54,262,832 H74Q probably damaging Het
Actg1 A G 11: 120,346,810 S49P possibly damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Aire T C 10: 78,042,958 D85G probably damaging Het
Akr1c18 T A 13: 4,145,309 D50V probably damaging Het
Ankrd13a C A 5: 114,792,109 A185E probably damaging Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Armc8 A T 9: 99,483,105 C661* probably null Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Bpifb9a T C 2: 154,268,200 probably null Het
Cdk14 T C 5: 5,380,082 K15R probably benign Het
Cdr1 A G X: 61,184,814 F249L probably benign Het
Cep250 A C 2: 155,981,453 H1009P probably damaging Het
Clasp2 A G 9: 113,911,500 T495A possibly damaging Het
Col19a1 C G 1: 24,559,753 G53A unknown Het
Cpne1 G A 2: 156,078,388 R166C probably damaging Het
Dtx3l G A 16: 35,936,427 H129Y probably benign Het
Ercc3 A G 18: 32,248,429 T433A probably benign Het
Gm9936 T A 5: 114,857,421 probably benign Het
Grina T C 15: 76,248,534 V167A probably damaging Het
Hcfc2 A G 10: 82,738,980 N618D probably benign Het
Herpud1 T C 8: 94,392,206 V196A probably benign Het
Hist3h2a T A 11: 58,954,928 L64Q probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Igll1 A G 16: 16,863,775 S39P probably benign Het
Kdm5a T C 6: 120,431,990 S1545P probably benign Het
Klra8 C A 6: 130,115,573 C255F probably damaging Het
Krtap4-6 A T 11: 99,665,572 C110S unknown Het
Lef1 T A 3: 131,111,587 I39N probably damaging Het
Lnpep G A 17: 17,579,063 T110I probably damaging Het
Lrp1 T A 10: 127,540,694 T4282S probably benign Het
Lrp6 A G 6: 134,480,374 probably null Het
Ly6g5b A C 17: 35,114,678 S53A possibly damaging Het
M6pr T G 6: 122,313,373 N98K probably damaging Het
Mal2 T C 15: 54,600,740 *176Q probably null Het
Mansc1 T C 6: 134,610,311 D301G possibly damaging Het
March1 C A 8: 66,121,821 N11K probably damaging Het
Mast3 T A 8: 70,787,363 I338F probably benign Het
Mcm3 A G 1: 20,803,580 L772P probably damaging Het
Mib2 C T 4: 155,657,880 G176D probably damaging Het
Mier2 A T 10: 79,541,202 probably null Het
Mogs C T 6: 83,117,650 R483* probably null Het
Msl2 G T 9: 101,075,251 probably benign Het
Naa16 A T 14: 79,345,059 M530K probably damaging Het
Nde1 A T 16: 14,169,457 probably benign Het
Ndufb10 T C 17: 24,722,529 probably null Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Npffr2 T A 5: 89,582,892 I227N probably damaging Het
Nup210l T A 3: 90,185,432 L1231Q probably damaging Het
Olfr1355 T C 10: 78,879,388 I72T possibly damaging Het
Olfr453 A G 6: 42,744,850 E271G probably damaging Het
Pclo C A 5: 14,521,501 P300Q probably damaging Het
Pik3c2a T A 7: 116,350,931 probably null Het
Plekha5 T A 6: 140,534,564 probably null Het
Pls1 A G 9: 95,761,365 V527A possibly damaging Het
Ppfia2 T C 10: 106,474,677 M15T probably benign Het
Prkd2 T A 7: 16,847,677 C152* probably null Het
Ptprq T G 10: 107,667,422 K792Q probably damaging Het
Rbbp8 T C 18: 11,720,624 M296T probably benign Het
Rfc3 T C 5: 151,647,538 probably null Het
Rnf17 A G 14: 56,486,969 N1090S probably benign Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Sdsl G A 5: 120,463,153 T18M probably damaging Het
Sepsecs T A 5: 52,647,624 Q365L probably benign Het
Sgta A T 10: 81,051,296 V45E probably damaging Het
Slc25a46 A T 18: 31,609,725 H29Q probably benign Het
Slc2a8 A C 2: 32,981,380 V136G probably benign Het
Smg7 A T 1: 152,860,508 N166K probably damaging Het
Spata21 C T 4: 141,107,329 Q505* probably null Het
Strn4 T C 7: 16,833,028 S458P possibly damaging Het
Tbc1d22a C T 15: 86,299,684 T248M probably damaging Het
Trabd T A 15: 89,084,726 M149K possibly damaging Het
Trpv3 A T 11: 73,279,827 N178Y probably damaging Het
Try5 C T 6: 41,314,651 probably null Het
Tsg101 C T 7: 46,908,904 probably null Het
Ube3b A G 5: 114,411,149 E738G probably damaging Het
Unc13d A G 11: 116,068,755 S631P probably damaging Het
Unc5d T C 8: 28,758,979 T297A probably damaging Het
Usp18 A T 6: 121,268,550 E1V probably damaging Het
Vapb C A 2: 173,771,598 P97T probably benign Het
Vmn1r33 T A 6: 66,612,372 D66V probably benign Het
Vmn2r19 T A 6: 123,315,995 M332K probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vwde C A 6: 13,208,338 G182C possibly damaging Het
Wdfy3 A C 5: 101,860,486 S2778A probably null Het
Zbtb2 T A 10: 4,369,757 I90F possibly damaging Het
Zfp518b C A 5: 38,672,002 V887F probably benign Het
Zfp790 A G 7: 29,828,861 T324A probably benign Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Bbs10
AlleleSourceChrCoordTypePredicted EffectPPH Score
chalky UTSW 10 111299761 missense probably damaging 1.00
wampum UTSW 10 111300013 missense probably damaging 1.00
R0097:Bbs10 UTSW 10 111298844 missense probably damaging 1.00
R0117:Bbs10 UTSW 10 111299333 missense possibly damaging 0.94
R0189:Bbs10 UTSW 10 111301065 missense probably damaging 1.00
R0373:Bbs10 UTSW 10 111300052 missense probably damaging 1.00
R0761:Bbs10 UTSW 10 111299383 missense probably damaging 1.00
R1319:Bbs10 UTSW 10 111298874 missense probably damaging 1.00
R1986:Bbs10 UTSW 10 111299257 missense probably damaging 1.00
R2361:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R3716:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R3717:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4407:Bbs10 UTSW 10 111299859 missense probably benign 0.00
R4583:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4607:Bbs10 UTSW 10 111300820 missense probably damaging 0.99
R4607:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4608:Bbs10 UTSW 10 111300820 missense probably damaging 0.99
R4608:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4609:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4646:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4647:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4648:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4730:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4822:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R4832:Bbs10 UTSW 10 111301134 missense probably benign 0.02
R5056:Bbs10 UTSW 10 111300540 missense probably benign 0.00
R6285:Bbs10 UTSW 10 111299761 missense probably damaging 1.00
R6604:Bbs10 UTSW 10 111301104 missense possibly damaging 0.51
R7120:Bbs10 UTSW 10 111299449 missense possibly damaging 0.74
R7174:Bbs10 UTSW 10 111300767 nonsense probably null
R7376:Bbs10 UTSW 10 111299250 missense probably benign 0.08
R7701:Bbs10 UTSW 10 111300013 missense probably damaging 1.00
R8146:Bbs10 UTSW 10 111300535 missense probably benign 0.05
R8260:Bbs10 UTSW 10 111300243 nonsense probably null
Z1176:Bbs10 UTSW 10 111298908 critical splice donor site probably null
Z1176:Bbs10 UTSW 10 111299657 missense probably benign 0.26
Z1176:Bbs10 UTSW 10 111301124 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACAGCAGAAGACACTGG -3'
(R):5'- ACTGACTCGAACCCTGATTGAC -3'

Sequencing Primer
(F):5'- TTCGAACACTTACAGGTCTCAG -3'
(R):5'- GATTGACCACTTACCATGGGTTGAC -3'
Posted On2014-08-25