Incidental Mutation 'R1988:Cnot1'
ID 222861
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene Name CCR4-NOT transcription complex, subunit 1
Synonyms 6030411K04Rik
MMRRC Submission 040000-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1988 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 96446079-96534092 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96468572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1417 (V1417A)
Ref Sequence ENSEMBL: ENSMUSP00000148807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000068452
AA Change: V1419A

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: V1419A

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083155
Predicted Effect possibly damaging
Transcript: ENSMUST00000098473
AA Change: V1424A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: V1424A

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211887
AA Change: V1417A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000211973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212195
Predicted Effect possibly damaging
Transcript: ENSMUST00000213006
AA Change: V1424A

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212340
Predicted Effect probably benign
Transcript: ENSMUST00000212415
Meta Mutation Damage Score 0.5116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (79/82)
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,854,394 (GRCm39) D216V possibly damaging Het
2610021A01Rik C T 7: 41,276,081 (GRCm39) R595* probably null Het
Adgrl3 A G 5: 81,836,414 (GRCm39) D724G probably damaging Het
Akap6 T C 12: 53,187,578 (GRCm39) F1664S possibly damaging Het
Akt1 T C 12: 112,621,585 (GRCm39) I404V probably benign Het
Anxa13 T A 15: 58,205,344 (GRCm39) noncoding transcript Het
Atoh1 T C 6: 64,706,617 (GRCm39) V104A probably benign Het
Brwd1 T C 16: 95,822,437 (GRCm39) D1256G probably damaging Het
C9 ATTTT ATTT 15: 6,512,619 (GRCm39) probably null Het
Cd164 A G 10: 41,399,177 (GRCm39) T89A probably benign Het
Cep350 G C 1: 155,808,850 (GRCm39) N575K possibly damaging Het
Chrm5 A G 2: 112,310,597 (GRCm39) V173A probably damaging Het
Cntnap3 T C 13: 64,906,204 (GRCm39) T801A probably damaging Het
Cntnap5b A C 1: 99,999,865 (GRCm39) K208Q possibly damaging Het
Crx A T 7: 15,603,272 (GRCm39) V107D possibly damaging Het
Csrnp2 A G 15: 100,387,321 (GRCm39) F49S probably damaging Het
Ctbp1 A G 5: 33,408,248 (GRCm39) L228P possibly damaging Het
Ctdp1 A T 18: 80,492,616 (GRCm39) D626E possibly damaging Het
Cyp1a2 T C 9: 57,589,569 (GRCm39) T82A possibly damaging Het
Dnah3 T A 7: 119,566,793 (GRCm39) T2478S possibly damaging Het
Dnah3 T G 7: 119,567,182 (GRCm39) D2348A probably damaging Het
Dnah5 T C 15: 28,343,737 (GRCm39) I2379T probably damaging Het
Dnah6 A G 6: 73,069,175 (GRCm39) I2504T probably damaging Het
Dnase1l2 A C 17: 24,660,625 (GRCm39) W138G probably damaging Het
Dop1b T A 16: 93,563,061 (GRCm39) I855N probably damaging Het
Dsc3 T A 18: 20,098,903 (GRCm39) N759Y possibly damaging Het
Dtx2 C T 5: 136,061,147 (GRCm39) R510* probably null Het
Fat4 G T 3: 38,941,264 (GRCm39) M52I probably benign Het
Fat4 G A 3: 39,050,239 (GRCm39) E4034K probably damaging Het
Fezf2 T C 14: 12,344,350 (GRCm38) K279R probably damaging Het
Fsip2 G T 2: 82,806,861 (GRCm39) W1060L possibly damaging Het
G6pc1 T A 11: 101,258,768 (GRCm39) I49N probably damaging Het
Gars1 A G 6: 55,054,757 (GRCm39) E688G probably null Het
Gdf11 T C 10: 128,721,111 (GRCm39) N361S probably benign Het
Gli3 A C 13: 15,900,965 (GRCm39) M1451L probably benign Het
Heatr3 T C 8: 88,876,945 (GRCm39) I329T probably benign Het
Herc3 T G 6: 58,861,960 (GRCm39) probably null Het
Hrnr A G 3: 93,239,911 (GRCm39) N3383S unknown Het
Igsf3 A T 3: 101,338,612 (GRCm39) I309F probably benign Het
Kif21b C T 1: 136,080,002 (GRCm39) R513W probably damaging Het
Kif7 G T 7: 79,348,989 (GRCm39) H1195Q probably benign Het
Lpcat4 T C 2: 112,072,887 (GRCm39) V182A possibly damaging Het
Map3k21 T A 8: 126,654,294 (GRCm39) I371N probably benign Het
Mns1 G A 9: 72,356,041 (GRCm39) probably null Het
Myo3a A G 2: 22,468,140 (GRCm39) T465A possibly damaging Het
Nlrc4 A T 17: 74,733,938 (GRCm39) S992T probably benign Het
Notch4 G A 17: 34,806,562 (GRCm39) G1833E possibly damaging Het
Or52ad1 T A 7: 102,995,316 (GRCm39) Y273F possibly damaging Het
Or52n2 T C 7: 104,542,110 (GRCm39) T242A probably damaging Het
Or5g29 G A 2: 85,420,985 (GRCm39) V34I probably benign Het
Or5p5 A T 7: 107,413,907 (GRCm39) I39L probably benign Het
Or8a1b A T 9: 37,622,993 (GRCm39) I194K possibly damaging Het
Pcdh9 G A 14: 94,125,741 (GRCm39) P143L probably damaging Het
Pik3cd T A 4: 149,747,660 (GRCm39) T28S probably damaging Het
Pkd1 G T 17: 24,795,566 (GRCm39) probably null Het
Plk4 A T 3: 40,760,252 (GRCm39) S383C possibly damaging Het
Plxna2 T C 1: 194,326,297 (GRCm39) L77P probably damaging Het
Ppm1f T C 16: 16,741,530 (GRCm39) S335P probably damaging Het
Prr16 C T 18: 51,436,349 (GRCm39) P276L probably damaging Het
Rilp A G 11: 75,401,759 (GRCm39) probably null Het
Rspry1 A G 8: 95,358,682 (GRCm39) probably null Het
Serpinb9b T C 13: 33,213,542 (GRCm39) V33A probably benign Het
Slc4a10 C A 2: 62,098,548 (GRCm39) Q561K probably damaging Het
Smyd5 T C 6: 85,415,118 (GRCm39) I42T possibly damaging Het
Stk17b T C 1: 53,800,241 (GRCm39) N246D probably damaging Het
Suco T C 1: 161,646,380 (GRCm39) probably null Het
Tecpr1 C T 5: 144,141,515 (GRCm39) V785M possibly damaging Het
Telo2 C T 17: 25,320,642 (GRCm39) V756I probably benign Het
Tgm1 C T 14: 55,943,034 (GRCm39) R602H probably benign Het
Timeless A G 10: 128,080,056 (GRCm39) T402A probably damaging Het
Tnfaip2 T A 12: 111,416,325 (GRCm39) probably null Het
Trgc3 C A 13: 19,445,164 (GRCm39) F37L probably damaging Het
Trim5 A G 7: 103,914,828 (GRCm39) S414P probably damaging Het
Txnip A G 3: 96,467,066 (GRCm39) T247A possibly damaging Het
Vmn1r174 A T 7: 23,454,050 (GRCm39) T239S probably damaging Het
Vmn1r231 T A 17: 21,110,212 (GRCm39) E234D probably damaging Het
Zranb3 A T 1: 127,887,480 (GRCm39) N982K probably benign Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 96,452,707 (GRCm39) missense probably damaging 1.00
IGL01340:Cnot1 APN 8 96,487,165 (GRCm39) missense probably damaging 1.00
IGL01457:Cnot1 APN 8 96,467,637 (GRCm39) missense probably damaging 1.00
IGL01505:Cnot1 APN 8 96,455,346 (GRCm39) missense probably damaging 0.98
IGL02401:Cnot1 APN 8 96,482,761 (GRCm39) missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 96,500,113 (GRCm39) missense probably damaging 1.00
IGL02696:Cnot1 APN 8 96,471,645 (GRCm39) missense probably benign 0.00
IGL02754:Cnot1 APN 8 96,481,706 (GRCm39) missense probably benign 0.03
IGL03092:Cnot1 APN 8 96,496,243 (GRCm39) intron probably benign
IGL03174:Cnot1 APN 8 96,487,983 (GRCm39) missense probably damaging 1.00
IGL03310:Cnot1 APN 8 96,462,308 (GRCm39) splice site probably benign
IGL03371:Cnot1 APN 8 96,501,344 (GRCm39) missense possibly damaging 0.85
Affiliate UTSW 8 96,491,753 (GRCm39) missense probably damaging 0.99
Barge UTSW 8 96,460,757 (GRCm39) missense probably benign 0.13
Byproduct UTSW 8 96,472,275 (GRCm39) frame shift probably null
Chairman UTSW 8 96,491,655 (GRCm39) missense possibly damaging 0.95
cohort UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
Director UTSW 8 96,491,690 (GRCm39) missense probably benign 0.15
kowloon UTSW 8 96,515,286 (GRCm39) missense probably damaging 1.00
Quorum UTSW 8 96,452,746 (GRCm39) missense probably damaging 1.00
tugboat UTSW 8 96,500,246 (GRCm39) missense probably damaging 0.99
Xiao UTSW 8 96,457,048 (GRCm39) missense probably damaging 1.00
BB001:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB003:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB011:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB013:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R0008:Cnot1 UTSW 8 96,487,969 (GRCm39) missense probably damaging 1.00
R0008:Cnot1 UTSW 8 96,487,969 (GRCm39) missense probably damaging 1.00
R0091:Cnot1 UTSW 8 96,489,772 (GRCm39) missense probably damaging 1.00
R0335:Cnot1 UTSW 8 96,498,628 (GRCm39) missense probably benign 0.02
R0409:Cnot1 UTSW 8 96,475,483 (GRCm39) missense probably damaging 0.96
R0445:Cnot1 UTSW 8 96,486,836 (GRCm39) missense probably damaging 1.00
R1505:Cnot1 UTSW 8 96,455,295 (GRCm39) missense probably damaging 1.00
R1517:Cnot1 UTSW 8 96,469,841 (GRCm39) missense probably benign 0.38
R1640:Cnot1 UTSW 8 96,496,460 (GRCm39) missense probably damaging 0.98
R1737:Cnot1 UTSW 8 96,474,904 (GRCm39) missense probably damaging 0.98
R1755:Cnot1 UTSW 8 96,451,205 (GRCm39) missense probably damaging 1.00
R1901:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R2051:Cnot1 UTSW 8 96,451,221 (GRCm39) missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 96,466,469 (GRCm39) missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 96,501,986 (GRCm39) missense probably damaging 1.00
R2116:Cnot1 UTSW 8 96,452,781 (GRCm39) missense probably damaging 1.00
R2191:Cnot1 UTSW 8 96,488,054 (GRCm39) missense probably damaging 0.98
R2238:Cnot1 UTSW 8 96,496,149 (GRCm39) missense probably benign 0.04
R2239:Cnot1 UTSW 8 96,496,149 (GRCm39) missense probably benign 0.04
R2251:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2252:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2253:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2315:Cnot1 UTSW 8 96,475,690 (GRCm39) missense probably damaging 1.00
R2431:Cnot1 UTSW 8 96,501,280 (GRCm39) missense probably damaging 1.00
R2988:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
R3109:Cnot1 UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
R3114:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 96,500,246 (GRCm39) missense probably damaging 0.99
R4359:Cnot1 UTSW 8 96,466,476 (GRCm39) missense probably damaging 1.00
R4382:Cnot1 UTSW 8 96,496,407 (GRCm39) missense probably damaging 0.97
R4747:Cnot1 UTSW 8 96,501,310 (GRCm39) missense probably benign 0.27
R4910:Cnot1 UTSW 8 96,459,859 (GRCm39) missense probably benign 0.43
R4913:Cnot1 UTSW 8 96,489,695 (GRCm39) missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 96,448,254 (GRCm39) missense probably damaging 1.00
R5056:Cnot1 UTSW 8 96,467,636 (GRCm39) missense probably damaging 1.00
R5092:Cnot1 UTSW 8 96,479,396 (GRCm39) missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 96,486,815 (GRCm39) missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 96,483,983 (GRCm39) missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 96,470,924 (GRCm39) missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 96,460,775 (GRCm39) nonsense probably null
R5956:Cnot1 UTSW 8 96,481,606 (GRCm39) critical splice donor site probably null
R5981:Cnot1 UTSW 8 96,515,293 (GRCm39) missense probably damaging 1.00
R6093:Cnot1 UTSW 8 96,475,522 (GRCm39) missense probably benign 0.03
R6108:Cnot1 UTSW 8 96,457,048 (GRCm39) missense probably damaging 1.00
R6261:Cnot1 UTSW 8 96,468,549 (GRCm39) missense probably benign 0.00
R6632:Cnot1 UTSW 8 96,499,895 (GRCm39) intron probably benign
R6882:Cnot1 UTSW 8 96,447,054 (GRCm39) missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 96,451,160 (GRCm39) missense probably damaging 1.00
R6985:Cnot1 UTSW 8 96,460,757 (GRCm39) missense probably benign 0.13
R7210:Cnot1 UTSW 8 96,515,286 (GRCm39) missense probably damaging 1.00
R7410:Cnot1 UTSW 8 96,459,787 (GRCm39) missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 96,454,276 (GRCm39) missense probably damaging 1.00
R7624:Cnot1 UTSW 8 96,478,447 (GRCm39) missense probably damaging 1.00
R7695:Cnot1 UTSW 8 96,497,260 (GRCm39) missense probably benign 0.03
R7703:Cnot1 UTSW 8 96,486,726 (GRCm39) critical splice donor site probably null
R7771:Cnot1 UTSW 8 96,491,753 (GRCm39) missense probably damaging 0.99
R7800:Cnot1 UTSW 8 96,491,690 (GRCm39) missense probably benign 0.15
R7809:Cnot1 UTSW 8 96,478,406 (GRCm39) missense probably damaging 1.00
R7857:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7914:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7924:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7926:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7981:Cnot1 UTSW 8 96,489,797 (GRCm39) missense probably damaging 1.00
R8004:Cnot1 UTSW 8 96,479,380 (GRCm39) missense probably benign 0.03
R8061:Cnot1 UTSW 8 96,491,655 (GRCm39) missense possibly damaging 0.95
R8185:Cnot1 UTSW 8 96,487,979 (GRCm39) missense probably damaging 1.00
R8269:Cnot1 UTSW 8 96,478,389 (GRCm39) missense probably damaging 1.00
R8306:Cnot1 UTSW 8 96,473,649 (GRCm39) missense probably benign 0.05
R8322:Cnot1 UTSW 8 96,496,472 (GRCm39) missense probably benign 0.00
R8427:Cnot1 UTSW 8 96,460,952 (GRCm39) missense probably benign 0.01
R8723:Cnot1 UTSW 8 96,462,907 (GRCm39) missense probably benign 0.00
R8934:Cnot1 UTSW 8 96,491,695 (GRCm39) missense probably benign 0.04
R9025:Cnot1 UTSW 8 96,475,660 (GRCm39) missense probably benign
R9179:Cnot1 UTSW 8 96,500,054 (GRCm39) missense probably benign 0.16
R9280:Cnot1 UTSW 8 96,497,227 (GRCm39) missense probably benign 0.15
R9285:Cnot1 UTSW 8 96,452,746 (GRCm39) missense probably damaging 1.00
R9299:Cnot1 UTSW 8 96,468,448 (GRCm39) missense probably damaging 1.00
R9337:Cnot1 UTSW 8 96,468,448 (GRCm39) missense probably damaging 1.00
R9480:Cnot1 UTSW 8 96,497,338 (GRCm39) missense possibly damaging 0.94
R9548:Cnot1 UTSW 8 96,482,854 (GRCm39) missense probably benign 0.02
R9601:Cnot1 UTSW 8 96,482,835 (GRCm39) missense probably benign 0.02
R9629:Cnot1 UTSW 8 96,455,874 (GRCm39) missense probably damaging 0.98
R9752:Cnot1 UTSW 8 96,488,019 (GRCm39) missense probably damaging 1.00
R9764:Cnot1 UTSW 8 96,496,209 (GRCm39) missense probably benign 0.00
R9789:Cnot1 UTSW 8 96,455,772 (GRCm39) missense probably damaging 1.00
X0050:Cnot1 UTSW 8 96,469,726 (GRCm39) splice site probably null
Z1176:Cnot1 UTSW 8 96,474,905 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGGCCCAAGCTCTTACAGAC -3'
(R):5'- TAGCATTGAAGGAGTACCAGAGTC -3'

Sequencing Primer
(F):5'- GTACACAAAACAGTCTGCTTACACG -3'
(R):5'- CAGATGTGACTTGTGCCTTGTTTCC -3'
Posted On 2014-08-25