Incidental Mutation 'R1988:Map3k21'
ID222862
Institutional Source Beutler Lab
Gene Symbol Map3k21
Ensembl Gene ENSMUSG00000031853
Gene Namemitogen-activated protein kinase kinase kinase 21
SynonymsBC021891
MMRRC Submission 040000-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R1988 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location125910450-125947440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125927555 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 371 (I371N)
Ref Sequence ENSEMBL: ENSMUSP00000034316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034316]
Predicted Effect probably benign
Transcript: ENSMUST00000034316
AA Change: I371N

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000034316
Gene: ENSMUSG00000031853
AA Change: I371N

DomainStartEndE-ValueType
SH3 27 87 1.1e-18 SMART
TyrKc 110 382 6.04e-82 SMART
coiled coil region 402 474 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
low complexity region 661 677 N/A INTRINSIC
low complexity region 740 758 N/A INTRINSIC
low complexity region 766 788 N/A INTRINSIC
Meta Mutation Damage Score 0.0762 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (79/82)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,896 D216V possibly damaging Het
2610021A01Rik C T 7: 41,626,657 R595* probably null Het
Adgrl3 A G 5: 81,688,567 D724G probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Akt1 T C 12: 112,655,151 I404V probably benign Het
Anxa13 T A 15: 58,341,948 noncoding transcript Het
Atoh1 T C 6: 64,729,633 V104A probably benign Het
Brwd1 T C 16: 96,021,237 D1256G probably damaging Het
C9 ATTTT ATTT 15: 6,483,138 probably null Het
Cd164 A G 10: 41,523,181 T89A probably benign Het
Cep350 G C 1: 155,933,104 N575K possibly damaging Het
Chrm5 A G 2: 112,480,252 V173A probably damaging Het
Cnot1 A G 8: 95,741,944 V1417A possibly damaging Het
Cntnap3 T C 13: 64,758,390 T801A probably damaging Het
Cntnap5b A C 1: 100,072,140 K208Q possibly damaging Het
Crx A T 7: 15,869,347 V107D possibly damaging Het
Csrnp2 A G 15: 100,489,440 F49S probably damaging Het
Ctbp1 A G 5: 33,250,904 L228P possibly damaging Het
Ctdp1 A T 18: 80,449,401 D626E possibly damaging Het
Cyp1a2 T C 9: 57,682,286 T82A possibly damaging Het
Dnah3 T A 7: 119,967,570 T2478S possibly damaging Het
Dnah3 T G 7: 119,967,959 D2348A probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 A G 6: 73,092,192 I2504T probably damaging Het
Dnase1l2 A C 17: 24,441,651 W138G probably damaging Het
Dopey2 T A 16: 93,766,173 I855N probably damaging Het
Dsc3 T A 18: 19,965,846 N759Y possibly damaging Het
Dtx2 C T 5: 136,032,293 R510* probably null Het
Fat4 G T 3: 38,887,115 M52I probably benign Het
Fat4 G A 3: 38,996,090 E4034K probably damaging Het
Fezf2 T C 14: 12,344,350 K279R probably damaging Het
Fsip2 G T 2: 82,976,517 W1060L possibly damaging Het
G6pc T A 11: 101,367,942 I49N probably damaging Het
Gars A G 6: 55,077,772 E688G probably null Het
Gdf11 T C 10: 128,885,242 N361S probably benign Het
Gli3 A C 13: 15,726,380 M1451L probably benign Het
Heatr3 T C 8: 88,150,317 I329T probably benign Het
Herc3 T G 6: 58,884,975 probably null Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Igsf3 A T 3: 101,431,296 I309F probably benign Het
Kif21b C T 1: 136,152,264 R513W probably damaging Het
Kif7 G T 7: 79,699,241 H1195Q probably benign Het
Lpcat4 T C 2: 112,242,542 V182A possibly damaging Het
Mns1 G A 9: 72,448,759 probably null Het
Myo3a A G 2: 22,578,128 T465A possibly damaging Het
Nlrc4 A T 17: 74,426,943 S992T probably benign Het
Notch4 G A 17: 34,587,588 G1833E possibly damaging Het
Olfr160 A T 9: 37,711,697 I194K possibly damaging Het
Olfr467 A T 7: 107,814,700 I39L probably benign Het
Olfr600 T A 7: 103,346,109 Y273F possibly damaging Het
Olfr666 T C 7: 104,892,903 T242A probably damaging Het
Olfr998 G A 2: 85,590,641 V34I probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pik3cd T A 4: 149,663,203 T28S probably damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Ppm1f T C 16: 16,923,666 S335P probably damaging Het
Prr16 C T 18: 51,303,277 P276L probably damaging Het
Rilp A G 11: 75,510,933 probably null Het
Rspry1 A G 8: 94,632,054 probably null Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Smyd5 T C 6: 85,438,136 I42T possibly damaging Het
Stk17b T C 1: 53,761,082 N246D probably damaging Het
Suco T C 1: 161,818,811 probably null Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tecpr1 C T 5: 144,204,697 V785M possibly damaging Het
Telo2 C T 17: 25,101,668 V756I probably benign Het
Tgm1 C T 14: 55,705,577 R602H probably benign Het
Timeless A G 10: 128,244,187 T402A probably damaging Het
Tnfaip2 T A 12: 111,449,891 probably null Het
Trim5 A G 7: 104,265,621 S414P probably damaging Het
Txnip A G 3: 96,559,750 T247A possibly damaging Het
Vmn1r174 A T 7: 23,754,625 T239S probably damaging Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Zranb3 A T 1: 127,959,743 N982K probably benign Het
Other mutations in Map3k21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Map3k21 APN 8 125944673 missense possibly damaging 0.52
IGL01919:Map3k21 APN 8 125942132 missense probably damaging 0.97
IGL02065:Map3k21 APN 8 125941658 missense probably benign 0.01
IGL02123:Map3k21 APN 8 125926110 missense probably damaging 1.00
IGL02127:Map3k21 APN 8 125942147 missense probably benign
IGL02863:Map3k21 APN 8 125927541 missense probably benign 0.02
IGL03194:Map3k21 APN 8 125924062 missense possibly damaging 0.90
PIT4142001:Map3k21 UTSW 8 125937308 missense probably damaging 0.98
R0238:Map3k21 UTSW 8 125944970 missense possibly damaging 0.67
R0238:Map3k21 UTSW 8 125944970 missense possibly damaging 0.67
R0454:Map3k21 UTSW 8 125942119 missense probably benign
R0654:Map3k21 UTSW 8 125942020 missense probably benign 0.07
R1141:Map3k21 UTSW 8 125941732 missense probably benign 0.32
R1177:Map3k21 UTSW 8 125944838 missense probably benign 0.31
R1463:Map3k21 UTSW 8 125942137 missense probably benign 0.00
R1472:Map3k21 UTSW 8 125941678 missense probably benign
R1759:Map3k21 UTSW 8 125944780 missense probably benign
R2058:Map3k21 UTSW 8 125938722 missense probably benign 0.01
R2117:Map3k21 UTSW 8 125924042 missense probably benign 0.19
R2157:Map3k21 UTSW 8 125937266 missense probably benign
R2436:Map3k21 UTSW 8 125941615 nonsense probably null
R2507:Map3k21 UTSW 8 125939938 missense possibly damaging 0.73
R3125:Map3k21 UTSW 8 125941854 missense probably benign 0.26
R3746:Map3k21 UTSW 8 125935100 missense probably damaging 1.00
R4016:Map3k21 UTSW 8 125911185 missense probably damaging 1.00
R4647:Map3k21 UTSW 8 125942111 missense probably benign
R4648:Map3k21 UTSW 8 125942111 missense probably benign
R4864:Map3k21 UTSW 8 125927555 missense probably benign 0.04
R5642:Map3k21 UTSW 8 125938824 missense probably benign 0.17
R5694:Map3k21 UTSW 8 125944768 missense probably benign 0.04
R5950:Map3k21 UTSW 8 125941760 missense possibly damaging 0.93
R5982:Map3k21 UTSW 8 125911430 missense probably damaging 1.00
R6440:Map3k21 UTSW 8 125911137 missense probably damaging 1.00
R6550:Map3k21 UTSW 8 125937292 missense probably damaging 1.00
R6664:Map3k21 UTSW 8 125941871 missense probably benign 0.01
R6668:Map3k21 UTSW 8 125926113 missense possibly damaging 0.60
R6788:Map3k21 UTSW 8 125939866 missense probably benign 0.28
R7369:Map3k21 UTSW 8 125911116 missense possibly damaging 0.86
R7371:Map3k21 UTSW 8 125935065 missense probably damaging 0.99
R7381:Map3k21 UTSW 8 125944978 missense possibly damaging 0.83
R7388:Map3k21 UTSW 8 125927597 missense probably damaging 1.00
R7397:Map3k21 UTSW 8 125935116 missense probably damaging 1.00
R7497:Map3k21 UTSW 8 125927601 missense probably damaging 0.99
R7562:Map3k21 UTSW 8 125938800 missense probably damaging 1.00
R7564:Map3k21 UTSW 8 125927708 critical splice donor site probably null
R7824:Map3k21 UTSW 8 125910963 missense probably benign 0.01
R8351:Map3k21 UTSW 8 125944733 missense probably benign 0.00
R8451:Map3k21 UTSW 8 125944733 missense probably benign 0.00
R8461:Map3k21 UTSW 8 125944622 missense probably benign 0.05
R9005:Map3k21 UTSW 8 125910732 missense
Predicted Primers PCR Primer
(F):5'- ACCAAACATGCATGTGCG -3'
(R):5'- TGGTGAGACCACTCTCTTACC -3'

Sequencing Primer
(F):5'- AAACATGCATGTGCGGCCTG -3'
(R):5'- GGTGAGACCACTCTCTTACCTTCTC -3'
Posted On2014-08-25