Mutagenetix > Incidental Mutation

Incidental Mutation 'R1988:Olfr160'

222865

Institutional Source

Beutler Lab

Gene Symbol

Olfr160

Ensembl Gene

ENSMUSG00000061165

Gene Name

olfactory receptor 160

Synonyms

GA_x6K02T2PVTD-31389446-31388517, MOR171-3, M72, MOR171-3

MMRRC Submission

040000-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1988 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37708964-37716250 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 37711697 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 194 (I194K)

Ref Sequence

ENSEMBL: ENSMUSP00000151178 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000104875] [ENSMUST00000211952] [ENSMUST00000215727]

AlphaFold

Q8VGE3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000104875
AA Change: I194K

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000100468
Gene: ENSMUSG00000061165
AA Change: I194K

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	3.5e-48	PFAM
Pfam:7tm_1	41	290	6.7e-24	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211952
AA Change: I194K

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215727
AA Change: I194K

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.1%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele respond heterogeneously to odorants and display abnormal innervation of glomeruli by olfactory sensory axons in the olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	A	6: 146,952,896	D216V	possibly damaging	Het
2610021A01Rik	C	T	7: 41,626,657	R595*	probably null	Het
Adgrl3	A	G	5: 81,688,567	D724G	probably damaging	Het
Akap6	T	C	12: 53,140,795	F1664S	possibly damaging	Het
Akt1	T	C	12: 112,655,151	I404V	probably benign	Het
Anxa13	T	A	15: 58,341,948		noncoding transcript	Het
Atoh1	T	C	6: 64,729,633	V104A	probably benign	Het
Brwd1	T	C	16: 96,021,237	D1256G	probably damaging	Het
C9	ATTTT	ATTT	15: 6,483,138		probably null	Het
Cd164	A	G	10: 41,523,181	T89A	probably benign	Het
Cep350	G	C	1: 155,933,104	N575K	possibly damaging	Het
Chrm5	A	G	2: 112,480,252	V173A	probably damaging	Het
Cnot1	A	G	8: 95,741,944	V1417A	possibly damaging	Het
Cntnap3	T	C	13: 64,758,390	T801A	probably damaging	Het
Cntnap5b	A	C	1: 100,072,140	K208Q	possibly damaging	Het
Crx	A	T	7: 15,869,347	V107D	possibly damaging	Het
Csrnp2	A	G	15: 100,489,440	F49S	probably damaging	Het
Ctbp1	A	G	5: 33,250,904	L228P	possibly damaging	Het
Ctdp1	A	T	18: 80,449,401	D626E	possibly damaging	Het
Cyp1a2	T	C	9: 57,682,286	T82A	possibly damaging	Het
Dnah3	T	A	7: 119,967,570	T2478S	possibly damaging	Het
Dnah3	T	G	7: 119,967,959	D2348A	probably damaging	Het
Dnah5	T	C	15: 28,343,591	I2379T	probably damaging	Het
Dnah6	A	G	6: 73,092,192	I2504T	probably damaging	Het
Dnase1l2	A	C	17: 24,441,651	W138G	probably damaging	Het
Dopey2	T	A	16: 93,766,173	I855N	probably damaging	Het
Dsc3	T	A	18: 19,965,846	N759Y	possibly damaging	Het
Dtx2	C	T	5: 136,032,293	R510*	probably null	Het
Fat4	G	T	3: 38,887,115	M52I	probably benign	Het
Fat4	G	A	3: 38,996,090	E4034K	probably damaging	Het
Fezf2	T	C	14: 12,344,350	K279R	probably damaging	Het
Fsip2	G	T	2: 82,976,517	W1060L	possibly damaging	Het
G6pc	T	A	11: 101,367,942	I49N	probably damaging	Het
Gars	A	G	6: 55,077,772	E688G	probably null	Het
Gdf11	T	C	10: 128,885,242	N361S	probably benign	Het
Gli3	A	C	13: 15,726,380	M1451L	probably benign	Het
Heatr3	T	C	8: 88,150,317	I329T	probably benign	Het
Herc3	T	G	6: 58,884,975		probably null	Het
Hrnr	A	G	3: 93,332,604	N3383S	unknown	Het
Igsf3	A	T	3: 101,431,296	I309F	probably benign	Het
Kif21b	C	T	1: 136,152,264	R513W	probably damaging	Het
Kif7	G	T	7: 79,699,241	H1195Q	probably benign	Het
Lpcat4	T	C	2: 112,242,542	V182A	possibly damaging	Het
Map3k21	T	A	8: 125,927,555	I371N	probably benign	Het
Mns1	G	A	9: 72,448,759		probably null	Het
Myo3a	A	G	2: 22,578,128	T465A	possibly damaging	Het
Nlrc4	A	T	17: 74,426,943	S992T	probably benign	Het
Notch4	G	A	17: 34,587,588	G1833E	possibly damaging	Het
Olfr467	A	T	7: 107,814,700	I39L	probably benign	Het
Olfr600	T	A	7: 103,346,109	Y273F	possibly damaging	Het
Olfr666	T	C	7: 104,892,903	T242A	probably damaging	Het
Olfr998	G	A	2: 85,590,641	V34I	probably benign	Het
Pcdh9	G	A	14: 93,888,305	P143L	probably damaging	Het
Pik3cd	T	A	4: 149,663,203	T28S	probably damaging	Het
Pkd1	G	T	17: 24,576,592		probably null	Het
Plk4	A	T	3: 40,805,817	S383C	possibly damaging	Het
Plxna2	T	C	1: 194,643,989	L77P	probably damaging	Het
Ppm1f	T	C	16: 16,923,666	S335P	probably damaging	Het
Prr16	C	T	18: 51,303,277	P276L	probably damaging	Het
Rilp	A	G	11: 75,510,933		probably null	Het
Rspry1	A	G	8: 94,632,054		probably null	Het
Serpinb9b	T	C	13: 33,029,559	V33A	probably benign	Het
Slc4a10	C	A	2: 62,268,204	Q561K	probably damaging	Het
Smyd5	T	C	6: 85,438,136	I42T	possibly damaging	Het
Stk17b	T	C	1: 53,761,082	N246D	probably damaging	Het
Suco	T	C	1: 161,818,811		probably null	Het
Tcrg-C3	C	A	13: 19,260,994	F37L	probably damaging	Het
Tecpr1	C	T	5: 144,204,697	V785M	possibly damaging	Het
Telo2	C	T	17: 25,101,668	V756I	probably benign	Het
Tgm1	C	T	14: 55,705,577	R602H	probably benign	Het
Timeless	A	G	10: 128,244,187	T402A	probably damaging	Het
Tnfaip2	T	A	12: 111,449,891		probably null	Het
Trim5	A	G	7: 104,265,621	S414P	probably damaging	Het
Txnip	A	G	3: 96,559,750	T247A	possibly damaging	Het
Vmn1r174	A	T	7: 23,754,625	T239S	probably damaging	Het
Vmn1r231	T	A	17: 20,889,950	E234D	probably damaging	Het
Zranb3	A	T	1: 127,959,743	N982K	probably benign	Het

Other mutations in Olfr160

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01989:Olfr160	APN	9	37711836	missense	probably damaging	0.98
IGL02195:Olfr160	APN	9	37712121	missense	probably benign
R0099:Olfr160	UTSW	9	37711454	missense	probably damaging	0.99
R0124:Olfr160	UTSW	9	37711463	missense	possibly damaging	0.79
R0129:Olfr160	UTSW	9	37711940	missense	probably damaging	1.00
R0882:Olfr160	UTSW	9	37711872	missense	probably benign	0.02
R1855:Olfr160	UTSW	9	37711970	missense	possibly damaging	0.92
R2346:Olfr160	UTSW	9	37711365	missense	possibly damaging	0.50
R4164:Olfr160	UTSW	9	37711698	missense	probably benign	0.03
R4274:Olfr160	UTSW	9	37712068	missense	probably damaging	1.00
R4504:Olfr160	UTSW	9	37711464	missense	probably benign	0.03
R4505:Olfr160	UTSW	9	37711464	missense	probably benign	0.03
R4506:Olfr160	UTSW	9	37711464	missense	probably benign	0.03
R5017:Olfr160	UTSW	9	37711525	nonsense	probably null
R5268:Olfr160	UTSW	9	37712004	missense	probably damaging	1.00
R5316:Olfr160	UTSW	9	37711685	missense	possibly damaging	0.90
R5372:Olfr160	UTSW	9	37711938	missense	possibly damaging	0.49
R5385:Olfr160	UTSW	9	37712021	missense	probably damaging	1.00
R5822:Olfr160	UTSW	9	37711791	missense	probably benign	0.01
R5906:Olfr160	UTSW	9	37711805	missense	probably benign	0.23
R5990:Olfr160	UTSW	9	37712110	missense	probably damaging	0.99
R6842:Olfr160	UTSW	9	37711589	missense	probably benign
R7712:Olfr160	UTSW	9	37712133	missense	probably damaging	1.00
R8132:Olfr160	UTSW	9	37712073	missense	probably benign	0.41
R8435:Olfr160	UTSW	9	37711550	missense	probably damaging	1.00
R9054:Olfr160	UTSW	9	37711908	missense	probably damaging	1.00
R9378:Olfr160	UTSW	9	37712177	missense	probably damaging	1.00
Z1177:Olfr160	UTSW	9	37711564	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CATGAATGCTGTGGATCCATAGAAC -3'
(R):5'- TGGCCATCTGTCAACCCTTG -3'

Sequencing Primer
(F):5'- TGCTGTGGATCCATAGAACAAGCC -3'
(R):5'- ACCCTTGCTTTATAACATCATCATG -3'

Posted On

2014-08-25