Incidental Mutation 'R1988:Tnfaip2'
ID 222884
Institutional Source Beutler Lab
Gene Symbol Tnfaip2
Ensembl Gene ENSMUSG00000021281
Gene Name tumor necrosis factor, alpha-induced protein 2
Synonyms M-sec, Tnfip2, Exoc3l3
MMRRC Submission 040000-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1988 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 111408903-111421452 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 111416325 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102745] [ENSMUST00000109792] [ENSMUST00000129467] [ENSMUST00000172783] [ENSMUST00000174298]
AlphaFold Q61333
Predicted Effect probably null
Transcript: ENSMUST00000102745
SMART Domains Protein: ENSMUSP00000099806
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
Pfam:Sec6 157 688 1.3e-111 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109792
SMART Domains Protein: ENSMUSP00000105415
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
Pfam:Sec6 157 705 1.7e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127207
Predicted Effect probably benign
Transcript: ENSMUST00000129467
SMART Domains Protein: ENSMUSP00000133274
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156003
Predicted Effect probably benign
Transcript: ENSMUST00000172783
SMART Domains Protein: ENSMUSP00000133635
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173581
Predicted Effect probably benign
Transcript: ENSMUST00000174298
SMART Domains Protein: ENSMUSP00000133317
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
low complexity region 65 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221429
Meta Mutation Damage Score 0.9473 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a gene whose expression can be induced by the tumor necrosis factor alpha (TNF) in umbilical vein endothelial cells. The expression of this gene was shown to be induced by retinoic acid in a cell line expressing a oncogenic version of the retinoic acid receptor alpha fusion protein, which suggested that this gene may be a retinoic acid target gene in acute promyelocytic leukemia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,854,394 (GRCm39) D216V possibly damaging Het
2610021A01Rik C T 7: 41,276,081 (GRCm39) R595* probably null Het
Adgrl3 A G 5: 81,836,414 (GRCm39) D724G probably damaging Het
Akap6 T C 12: 53,187,578 (GRCm39) F1664S possibly damaging Het
Akt1 T C 12: 112,621,585 (GRCm39) I404V probably benign Het
Anxa13 T A 15: 58,205,344 (GRCm39) noncoding transcript Het
Atoh1 T C 6: 64,706,617 (GRCm39) V104A probably benign Het
Brwd1 T C 16: 95,822,437 (GRCm39) D1256G probably damaging Het
C9 ATTTT ATTT 15: 6,512,619 (GRCm39) probably null Het
Cd164 A G 10: 41,399,177 (GRCm39) T89A probably benign Het
Cep350 G C 1: 155,808,850 (GRCm39) N575K possibly damaging Het
Chrm5 A G 2: 112,310,597 (GRCm39) V173A probably damaging Het
Cnot1 A G 8: 96,468,572 (GRCm39) V1417A possibly damaging Het
Cntnap3 T C 13: 64,906,204 (GRCm39) T801A probably damaging Het
Cntnap5b A C 1: 99,999,865 (GRCm39) K208Q possibly damaging Het
Crx A T 7: 15,603,272 (GRCm39) V107D possibly damaging Het
Csrnp2 A G 15: 100,387,321 (GRCm39) F49S probably damaging Het
Ctbp1 A G 5: 33,408,248 (GRCm39) L228P possibly damaging Het
Ctdp1 A T 18: 80,492,616 (GRCm39) D626E possibly damaging Het
Cyp1a2 T C 9: 57,589,569 (GRCm39) T82A possibly damaging Het
Dnah3 T A 7: 119,566,793 (GRCm39) T2478S possibly damaging Het
Dnah3 T G 7: 119,567,182 (GRCm39) D2348A probably damaging Het
Dnah5 T C 15: 28,343,737 (GRCm39) I2379T probably damaging Het
Dnah6 A G 6: 73,069,175 (GRCm39) I2504T probably damaging Het
Dnase1l2 A C 17: 24,660,625 (GRCm39) W138G probably damaging Het
Dop1b T A 16: 93,563,061 (GRCm39) I855N probably damaging Het
Dsc3 T A 18: 20,098,903 (GRCm39) N759Y possibly damaging Het
Dtx2 C T 5: 136,061,147 (GRCm39) R510* probably null Het
Fat4 G T 3: 38,941,264 (GRCm39) M52I probably benign Het
Fat4 G A 3: 39,050,239 (GRCm39) E4034K probably damaging Het
Fezf2 T C 14: 12,344,350 (GRCm38) K279R probably damaging Het
Fsip2 G T 2: 82,806,861 (GRCm39) W1060L possibly damaging Het
G6pc1 T A 11: 101,258,768 (GRCm39) I49N probably damaging Het
Gars1 A G 6: 55,054,757 (GRCm39) E688G probably null Het
Gdf11 T C 10: 128,721,111 (GRCm39) N361S probably benign Het
Gli3 A C 13: 15,900,965 (GRCm39) M1451L probably benign Het
Heatr3 T C 8: 88,876,945 (GRCm39) I329T probably benign Het
Herc3 T G 6: 58,861,960 (GRCm39) probably null Het
Hrnr A G 3: 93,239,911 (GRCm39) N3383S unknown Het
Igsf3 A T 3: 101,338,612 (GRCm39) I309F probably benign Het
Kif21b C T 1: 136,080,002 (GRCm39) R513W probably damaging Het
Kif7 G T 7: 79,348,989 (GRCm39) H1195Q probably benign Het
Lpcat4 T C 2: 112,072,887 (GRCm39) V182A possibly damaging Het
Map3k21 T A 8: 126,654,294 (GRCm39) I371N probably benign Het
Mns1 G A 9: 72,356,041 (GRCm39) probably null Het
Myo3a A G 2: 22,468,140 (GRCm39) T465A possibly damaging Het
Nlrc4 A T 17: 74,733,938 (GRCm39) S992T probably benign Het
Notch4 G A 17: 34,806,562 (GRCm39) G1833E possibly damaging Het
Or52ad1 T A 7: 102,995,316 (GRCm39) Y273F possibly damaging Het
Or52n2 T C 7: 104,542,110 (GRCm39) T242A probably damaging Het
Or5g29 G A 2: 85,420,985 (GRCm39) V34I probably benign Het
Or5p5 A T 7: 107,413,907 (GRCm39) I39L probably benign Het
Or8a1b A T 9: 37,622,993 (GRCm39) I194K possibly damaging Het
Pcdh9 G A 14: 94,125,741 (GRCm39) P143L probably damaging Het
Pik3cd T A 4: 149,747,660 (GRCm39) T28S probably damaging Het
Pkd1 G T 17: 24,795,566 (GRCm39) probably null Het
Plk4 A T 3: 40,760,252 (GRCm39) S383C possibly damaging Het
Plxna2 T C 1: 194,326,297 (GRCm39) L77P probably damaging Het
Ppm1f T C 16: 16,741,530 (GRCm39) S335P probably damaging Het
Prr16 C T 18: 51,436,349 (GRCm39) P276L probably damaging Het
Rilp A G 11: 75,401,759 (GRCm39) probably null Het
Rspry1 A G 8: 95,358,682 (GRCm39) probably null Het
Serpinb9b T C 13: 33,213,542 (GRCm39) V33A probably benign Het
Slc4a10 C A 2: 62,098,548 (GRCm39) Q561K probably damaging Het
Smyd5 T C 6: 85,415,118 (GRCm39) I42T possibly damaging Het
Stk17b T C 1: 53,800,241 (GRCm39) N246D probably damaging Het
Suco T C 1: 161,646,380 (GRCm39) probably null Het
Tecpr1 C T 5: 144,141,515 (GRCm39) V785M possibly damaging Het
Telo2 C T 17: 25,320,642 (GRCm39) V756I probably benign Het
Tgm1 C T 14: 55,943,034 (GRCm39) R602H probably benign Het
Timeless A G 10: 128,080,056 (GRCm39) T402A probably damaging Het
Trgc3 C A 13: 19,445,164 (GRCm39) F37L probably damaging Het
Trim5 A G 7: 103,914,828 (GRCm39) S414P probably damaging Het
Txnip A G 3: 96,467,066 (GRCm39) T247A possibly damaging Het
Vmn1r174 A T 7: 23,454,050 (GRCm39) T239S probably damaging Het
Vmn1r231 T A 17: 21,110,212 (GRCm39) E234D probably damaging Het
Zranb3 A T 1: 127,887,480 (GRCm39) N982K probably benign Het
Other mutations in Tnfaip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Tnfaip2 APN 12 111,419,983 (GRCm39) missense probably damaging 1.00
IGL01352:Tnfaip2 APN 12 111,412,053 (GRCm39) missense probably damaging 1.00
IGL02550:Tnfaip2 APN 12 111,412,535 (GRCm39) missense probably damaging 1.00
R0103:Tnfaip2 UTSW 12 111,412,244 (GRCm39) missense probably benign 0.38
R0145:Tnfaip2 UTSW 12 111,412,292 (GRCm39) missense possibly damaging 0.87
R0324:Tnfaip2 UTSW 12 111,419,893 (GRCm39) missense probably damaging 1.00
R0609:Tnfaip2 UTSW 12 111,419,941 (GRCm39) missense probably benign 0.01
R0837:Tnfaip2 UTSW 12 111,417,141 (GRCm39) missense probably damaging 1.00
R1353:Tnfaip2 UTSW 12 111,411,403 (GRCm39) missense probably damaging 1.00
R1366:Tnfaip2 UTSW 12 111,415,756 (GRCm39) missense probably benign 0.00
R2109:Tnfaip2 UTSW 12 111,414,527 (GRCm39) missense probably damaging 1.00
R2147:Tnfaip2 UTSW 12 111,412,456 (GRCm39) missense probably damaging 1.00
R4003:Tnfaip2 UTSW 12 111,417,778 (GRCm39) splice site probably benign
R4402:Tnfaip2 UTSW 12 111,416,285 (GRCm39) missense probably benign 0.43
R4690:Tnfaip2 UTSW 12 111,411,682 (GRCm39) missense possibly damaging 0.66
R4718:Tnfaip2 UTSW 12 111,412,463 (GRCm39) missense possibly damaging 0.95
R5271:Tnfaip2 UTSW 12 111,414,894 (GRCm39) intron probably benign
R6478:Tnfaip2 UTSW 12 111,412,097 (GRCm39) missense probably damaging 1.00
R7623:Tnfaip2 UTSW 12 111,412,072 (GRCm39) missense probably damaging 0.98
R8951:Tnfaip2 UTSW 12 111,412,310 (GRCm39) missense probably benign 0.01
R9168:Tnfaip2 UTSW 12 111,411,382 (GRCm39) missense probably damaging 1.00
R9407:Tnfaip2 UTSW 12 111,412,161 (GRCm39) missense probably benign
R9607:Tnfaip2 UTSW 12 111,412,069 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCCAGAGAGCAAAGACCTAATGTAG -3'
(R):5'- TGTATATCCCCAGGAACAGCG -3'

Sequencing Primer
(F):5'- CTAATGTAGGATGCCTAGTCCAAG -3'
(R):5'- GGAACAGCGCATCTCCCTAG -3'
Posted On 2014-08-25