Incidental Mutation 'R1988:Tnfaip2'
ID222884
Institutional Source Beutler Lab
Gene Symbol Tnfaip2
Ensembl Gene ENSMUSG00000021281
Gene Nametumor necrosis factor, alpha-induced protein 2
SynonymsTnfaip2, tnfb94, Tnfip2
MMRRC Submission 040000-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1988 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111442469-111455018 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 111449891 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102745] [ENSMUST00000109792] [ENSMUST00000129467] [ENSMUST00000172783] [ENSMUST00000174298]
Predicted Effect probably null
Transcript: ENSMUST00000102745
SMART Domains Protein: ENSMUSP00000099806
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
Pfam:Sec6 157 688 1.3e-111 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109792
SMART Domains Protein: ENSMUSP00000105415
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
Pfam:Sec6 157 705 1.7e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127207
Predicted Effect probably benign
Transcript: ENSMUST00000129467
SMART Domains Protein: ENSMUSP00000133274
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156003
Predicted Effect probably benign
Transcript: ENSMUST00000172783
SMART Domains Protein: ENSMUSP00000133635
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173581
Predicted Effect probably benign
Transcript: ENSMUST00000174298
SMART Domains Protein: ENSMUSP00000133317
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
low complexity region 65 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221429
Meta Mutation Damage Score 0.9473 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a gene whose expression can be induced by the tumor necrosis factor alpha (TNF) in umbilical vein endothelial cells. The expression of this gene was shown to be induced by retinoic acid in a cell line expressing a oncogenic version of the retinoic acid receptor alpha fusion protein, which suggested that this gene may be a retinoic acid target gene in acute promyelocytic leukemia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,896 D216V possibly damaging Het
2610021A01Rik C T 7: 41,626,657 R595* probably null Het
Adgrl3 A G 5: 81,688,567 D724G probably damaging Het
Akap6 T C 12: 53,140,795 F1664S possibly damaging Het
Akt1 T C 12: 112,655,151 I404V probably benign Het
Anxa13 T A 15: 58,341,948 noncoding transcript Het
Atoh1 T C 6: 64,729,633 V104A probably benign Het
Brwd1 T C 16: 96,021,237 D1256G probably damaging Het
C9 ATTTT ATTT 15: 6,483,138 probably null Het
Cd164 A G 10: 41,523,181 T89A probably benign Het
Cep350 G C 1: 155,933,104 N575K possibly damaging Het
Chrm5 A G 2: 112,480,252 V173A probably damaging Het
Cnot1 A G 8: 95,741,944 V1417A possibly damaging Het
Cntnap3 T C 13: 64,758,390 T801A probably damaging Het
Cntnap5b A C 1: 100,072,140 K208Q possibly damaging Het
Crx A T 7: 15,869,347 V107D possibly damaging Het
Csrnp2 A G 15: 100,489,440 F49S probably damaging Het
Ctbp1 A G 5: 33,250,904 L228P possibly damaging Het
Ctdp1 A T 18: 80,449,401 D626E possibly damaging Het
Cyp1a2 T C 9: 57,682,286 T82A possibly damaging Het
Dnah3 T A 7: 119,967,570 T2478S possibly damaging Het
Dnah3 T G 7: 119,967,959 D2348A probably damaging Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
Dnah6 A G 6: 73,092,192 I2504T probably damaging Het
Dnase1l2 A C 17: 24,441,651 W138G probably damaging Het
Dopey2 T A 16: 93,766,173 I855N probably damaging Het
Dsc3 T A 18: 19,965,846 N759Y possibly damaging Het
Dtx2 C T 5: 136,032,293 R510* probably null Het
Fat4 G T 3: 38,887,115 M52I probably benign Het
Fat4 G A 3: 38,996,090 E4034K probably damaging Het
Fezf2 T C 14: 12,344,350 K279R probably damaging Het
Fsip2 G T 2: 82,976,517 W1060L possibly damaging Het
G6pc T A 11: 101,367,942 I49N probably damaging Het
Gars A G 6: 55,077,772 E688G probably null Het
Gdf11 T C 10: 128,885,242 N361S probably benign Het
Gli3 A C 13: 15,726,380 M1451L probably benign Het
Heatr3 T C 8: 88,150,317 I329T probably benign Het
Herc3 T G 6: 58,884,975 probably null Het
Hrnr A G 3: 93,332,604 N3383S unknown Het
Igsf3 A T 3: 101,431,296 I309F probably benign Het
Kif21b C T 1: 136,152,264 R513W probably damaging Het
Kif7 G T 7: 79,699,241 H1195Q probably benign Het
Lpcat4 T C 2: 112,242,542 V182A possibly damaging Het
Map3k21 T A 8: 125,927,555 I371N probably benign Het
Mns1 G A 9: 72,448,759 probably null Het
Myo3a A G 2: 22,578,128 T465A possibly damaging Het
Nlrc4 A T 17: 74,426,943 S992T probably benign Het
Notch4 G A 17: 34,587,588 G1833E possibly damaging Het
Olfr160 A T 9: 37,711,697 I194K possibly damaging Het
Olfr467 A T 7: 107,814,700 I39L probably benign Het
Olfr600 T A 7: 103,346,109 Y273F possibly damaging Het
Olfr666 T C 7: 104,892,903 T242A probably damaging Het
Olfr998 G A 2: 85,590,641 V34I probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pik3cd T A 4: 149,663,203 T28S probably damaging Het
Pkd1 G T 17: 24,576,592 probably null Het
Plk4 A T 3: 40,805,817 S383C possibly damaging Het
Plxna2 T C 1: 194,643,989 L77P probably damaging Het
Ppm1f T C 16: 16,923,666 S335P probably damaging Het
Prr16 C T 18: 51,303,277 P276L probably damaging Het
Rilp A G 11: 75,510,933 probably null Het
Rspry1 A G 8: 94,632,054 probably null Het
Serpinb9b T C 13: 33,029,559 V33A probably benign Het
Slc4a10 C A 2: 62,268,204 Q561K probably damaging Het
Smyd5 T C 6: 85,438,136 I42T possibly damaging Het
Stk17b T C 1: 53,761,082 N246D probably damaging Het
Suco T C 1: 161,818,811 probably null Het
Tcrg-C3 C A 13: 19,260,994 F37L probably damaging Het
Tecpr1 C T 5: 144,204,697 V785M possibly damaging Het
Telo2 C T 17: 25,101,668 V756I probably benign Het
Tgm1 C T 14: 55,705,577 R602H probably benign Het
Timeless A G 10: 128,244,187 T402A probably damaging Het
Trim5 A G 7: 104,265,621 S414P probably damaging Het
Txnip A G 3: 96,559,750 T247A possibly damaging Het
Vmn1r174 A T 7: 23,754,625 T239S probably damaging Het
Vmn1r231 T A 17: 20,889,950 E234D probably damaging Het
Zranb3 A T 1: 127,959,743 N982K probably benign Het
Other mutations in Tnfaip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Tnfaip2 APN 12 111453549 missense probably damaging 1.00
IGL01352:Tnfaip2 APN 12 111445619 missense probably damaging 1.00
IGL02550:Tnfaip2 APN 12 111446101 missense probably damaging 1.00
R0103:Tnfaip2 UTSW 12 111445810 missense probably benign 0.38
R0145:Tnfaip2 UTSW 12 111445858 missense possibly damaging 0.87
R0324:Tnfaip2 UTSW 12 111453459 missense probably damaging 1.00
R0609:Tnfaip2 UTSW 12 111453507 missense probably benign 0.01
R0837:Tnfaip2 UTSW 12 111450707 missense probably damaging 1.00
R1353:Tnfaip2 UTSW 12 111444969 missense probably damaging 1.00
R1366:Tnfaip2 UTSW 12 111449322 missense probably benign 0.00
R2109:Tnfaip2 UTSW 12 111448093 missense probably damaging 1.00
R2147:Tnfaip2 UTSW 12 111446022 missense probably damaging 1.00
R4003:Tnfaip2 UTSW 12 111451344 splice site probably benign
R4402:Tnfaip2 UTSW 12 111449851 missense probably benign 0.43
R4690:Tnfaip2 UTSW 12 111445248 missense possibly damaging 0.66
R4718:Tnfaip2 UTSW 12 111446029 missense possibly damaging 0.95
R5271:Tnfaip2 UTSW 12 111448460 intron probably benign
R6478:Tnfaip2 UTSW 12 111445663 missense probably damaging 1.00
R7623:Tnfaip2 UTSW 12 111445638 missense probably damaging 0.98
R8951:Tnfaip2 UTSW 12 111445876 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCAGAGAGCAAAGACCTAATGTAG -3'
(R):5'- TGTATATCCCCAGGAACAGCG -3'

Sequencing Primer
(F):5'- CTAATGTAGGATGCCTAGTCCAAG -3'
(R):5'- GGAACAGCGCATCTCCCTAG -3'
Posted On2014-08-25