Mutagenetix > Incidental Mutation

Incidental Mutation 'R2015:Rnf17'

222887

Institutional Source

Beutler Lab

Gene Symbol

Rnf17

Ensembl Gene

ENSMUSG00000000365

Gene Name

ring finger protein 17

Synonyms

MMIP-2

MMRRC Submission

040024-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.644) question?

Stock #

R2015 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56402581-56525032 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 56486969 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1090 (N1090S)

Ref Sequence

ENSEMBL: ENSMUSP00000093469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095793]

AlphaFold

Q99MV7

Predicted Effect

probably benign
Transcript: ENSMUST00000095793
AA Change: N1090S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: N1090S

Domain	Start	End	E-Value	Type
Blast:RING	9	72	2e-15	BLAST
low complexity region	398	405	N/A	INTRINSIC
Pfam:TUDOR	440	522	8.2e-8	PFAM
TUDOR	750	807	4.32e-12	SMART
low complexity region	824	836	N/A	INTRINSIC
Blast:TUDOR	850	882	1e-8	BLAST
low complexity region	959	970	N/A	INTRINSIC
TUDOR	984	1042	1.29e-1	SMART
low complexity region	1128	1139	N/A	INTRINSIC
TUDOR	1245	1301	7.7e-9	SMART
low complexity region	1416	1430	N/A	INTRINSIC
TUDOR	1495	1554	1e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223646

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225621

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	C	A	11: 101,987,218	H35Q	probably damaging	Het
1700015F17Rik	T	A	5: 5,455,964	I106L	probably benign	Het
Abca9	A	T	11: 110,131,846	M1022K	probably benign	Het
Abhd4	T	A	14: 54,262,832	H74Q	probably damaging	Het
Actg1	A	G	11: 120,346,810	S49P	possibly damaging	Het
Adcy8	C	T	15: 64,767,878	G678S	probably benign	Het
Aire	T	C	10: 78,042,958	D85G	probably damaging	Het
Akr1c18	T	A	13: 4,145,309	D50V	probably damaging	Het
Ankrd13a	C	A	5: 114,792,109	A185E	probably damaging	Het
Apc	A	G	18: 34,315,591	I1813V	probably damaging	Het
Armc8	A	T	9: 99,483,105	C661*	probably null	Het
Bbs10	C	T	10: 111,300,855	Q610*	probably null	Het
Blm	T	C	7: 80,502,399	E600G	probably damaging	Het
Bpifb9a	T	C	2: 154,268,200		probably null	Het
Cdk14	T	C	5: 5,380,082	K15R	probably benign	Het
Cdr1	A	G	X: 61,184,814	F249L	probably benign	Het
Cep250	A	C	2: 155,981,453	H1009P	probably damaging	Het
Clasp2	A	G	9: 113,911,500	T495A	possibly damaging	Het
Col19a1	C	G	1: 24,559,753	G53A	unknown	Het
Cpne1	G	A	2: 156,078,388	R166C	probably damaging	Het
Dtx3l	G	A	16: 35,936,427	H129Y	probably benign	Het
Ercc3	A	G	18: 32,248,429	T433A	probably benign	Het
Gm9936	T	A	5: 114,857,421		probably benign	Het
Grina	T	C	15: 76,248,534	V167A	probably damaging	Het
Hcfc2	A	G	10: 82,738,980	N618D	probably benign	Het
Herpud1	T	C	8: 94,392,206	V196A	probably benign	Het
Hist3h2a	T	A	11: 58,954,928	L64Q	probably damaging	Het
Hlcs	A	G	16: 94,262,740	V487A	probably benign	Het
Hspa9	A	T	18: 34,946,648	Y243N	probably damaging	Het
Igll1	A	G	16: 16,863,775	S39P	probably benign	Het
Kdm5a	T	C	6: 120,431,990	S1545P	probably benign	Het
Klra8	C	A	6: 130,115,573	C255F	probably damaging	Het
Krtap4-6	A	T	11: 99,665,572	C110S	unknown	Het
Lef1	T	A	3: 131,111,587	I39N	probably damaging	Het
Lnpep	G	A	17: 17,579,063	T110I	probably damaging	Het
Lrp1	T	A	10: 127,540,694	T4282S	probably benign	Het
Lrp6	A	G	6: 134,480,374		probably null	Het
Ly6g5b	A	C	17: 35,114,678	S53A	possibly damaging	Het
M6pr	T	G	6: 122,313,373	N98K	probably damaging	Het
Mal2	T	C	15: 54,600,740	*176Q	probably null	Het
Mansc1	T	C	6: 134,610,311	D301G	possibly damaging	Het
March1	C	A	8: 66,121,821	N11K	probably damaging	Het
Mast3	T	A	8: 70,787,363	I338F	probably benign	Het
Mcm3	A	G	1: 20,803,580	L772P	probably damaging	Het
Mib2	C	T	4: 155,657,880	G176D	probably damaging	Het
Mier2	A	T	10: 79,541,202		probably null	Het
Mogs	C	T	6: 83,117,650	R483*	probably null	Het
Msl2	G	T	9: 101,075,251		probably benign	Het
Naa16	A	T	14: 79,345,059	M530K	probably damaging	Het
Nde1	A	T	16: 14,169,457		probably benign	Het
Ndufb10	T	C	17: 24,722,529		probably null	Het
Nhsl1	A	T	10: 18,511,592	R205W	probably damaging	Het
Npffr2	T	A	5: 89,582,892	I227N	probably damaging	Het
Nup210l	T	A	3: 90,185,432	L1231Q	probably damaging	Het
Olfr1355	T	C	10: 78,879,388	I72T	possibly damaging	Het
Olfr453	A	G	6: 42,744,850	E271G	probably damaging	Het
Pclo	C	A	5: 14,521,501	P300Q	probably damaging	Het
Pik3c2a	T	A	7: 116,350,931		probably null	Het
Plekha5	T	A	6: 140,534,564		probably null	Het
Pls1	A	G	9: 95,761,365	V527A	possibly damaging	Het
Ppfia2	T	C	10: 106,474,677	M15T	probably benign	Het
Prkd2	T	A	7: 16,847,677	C152*	probably null	Het
Ptprq	T	G	10: 107,667,422	K792Q	probably damaging	Het
Rbbp8	T	C	18: 11,720,624	M296T	probably benign	Het
Rfc3	T	C	5: 151,647,538		probably null	Het
Sash1	A	T	10: 8,729,413	V1071D	probably benign	Het
Sdsl	G	A	5: 120,463,153	T18M	probably damaging	Het
Sepsecs	T	A	5: 52,647,624	Q365L	probably benign	Het
Sgta	A	T	10: 81,051,296	V45E	probably damaging	Het
Slc25a46	A	T	18: 31,609,725	H29Q	probably benign	Het
Slc2a8	A	C	2: 32,981,380	V136G	probably benign	Het
Smg7	A	T	1: 152,860,508	N166K	probably damaging	Het
Spata21	C	T	4: 141,107,329	Q505*	probably null	Het
Strn4	T	C	7: 16,833,028	S458P	possibly damaging	Het
Tbc1d22a	C	T	15: 86,299,684	T248M	probably damaging	Het
Trabd	T	A	15: 89,084,726	M149K	possibly damaging	Het
Trpv3	A	T	11: 73,279,827	N178Y	probably damaging	Het
Try5	C	T	6: 41,314,651		probably null	Het
Tsg101	C	T	7: 46,908,904		probably null	Het
Ube3b	A	G	5: 114,411,149	E738G	probably damaging	Het
Unc13d	A	G	11: 116,068,755	S631P	probably damaging	Het
Unc5d	T	C	8: 28,758,979	T297A	probably damaging	Het
Usp18	A	T	6: 121,268,550	E1V	probably damaging	Het
Vapb	C	A	2: 173,771,598	P97T	probably benign	Het
Vmn1r33	T	A	6: 66,612,372	D66V	probably benign	Het
Vmn2r19	T	A	6: 123,315,995	M332K	probably benign	Het
Vmn2r71	T	A	7: 85,620,637	M452K	probably benign	Het
Vps13b	T	C	15: 35,607,142	S1074P	probably damaging	Het
Vwde	C	A	6: 13,208,338	G182C	possibly damaging	Het
Wdfy3	A	C	5: 101,860,486	S2778A	probably null	Het
Zbtb2	T	A	10: 4,369,757	I90F	possibly damaging	Het
Zfp518b	C	A	5: 38,672,002	V887F	probably benign	Het
Zfp790	A	G	7: 29,828,861	T324A	probably benign	Het
Zufsp	A	G	10: 33,929,824	V437A	possibly damaging	Het

Other mutations in Rnf17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Rnf17	APN	14	56421082	missense	probably damaging	0.99
IGL00717:Rnf17	APN	14	56465750	missense	probably benign	0.00
IGL00978:Rnf17	APN	14	56512271	missense	probably damaging	1.00
IGL01295:Rnf17	APN	14	56463064	nonsense	probably null
IGL01779:Rnf17	APN	14	56462063	missense	probably benign	0.06
IGL02132:Rnf17	APN	14	56421166	missense	probably benign	0.27
IGL02183:Rnf17	APN	14	56507868	missense	probably null	0.99
IGL02387:Rnf17	APN	14	56500587	missense	probably damaging	1.00
IGL02422:Rnf17	APN	14	56482135	missense	probably damaging	1.00
IGL03081:Rnf17	APN	14	56434371	missense	probably benign	0.03
IGL03269:Rnf17	APN	14	56427946	missense	possibly damaging	0.74
divest	UTSW	14	56424542	frame shift	probably null
Shed	UTSW	14	56512296	missense	probably damaging	1.00
R0046:Rnf17	UTSW	14	56471373	missense	probably damaging	1.00
R0046:Rnf17	UTSW	14	56471373	missense	probably damaging	1.00
R0089:Rnf17	UTSW	14	56514106	missense	probably damaging	1.00
R0189:Rnf17	UTSW	14	56482193	missense	probably null	1.00
R0243:Rnf17	UTSW	14	56482084	missense	possibly damaging	0.80
R0245:Rnf17	UTSW	14	56438609	missense	probably damaging	0.97
R0486:Rnf17	UTSW	14	56514175	missense	probably benign	0.43
R0554:Rnf17	UTSW	14	56522550	missense	probably damaging	1.00
R0840:Rnf17	UTSW	14	56475447	missense	probably damaging	1.00
R1169:Rnf17	UTSW	14	56514165	missense	possibly damaging	0.89
R1170:Rnf17	UTSW	14	56425631	missense	probably benign	0.10
R1200:Rnf17	UTSW	14	56467706	missense	probably benign	0.44
R1464:Rnf17	UTSW	14	56461911	missense	probably damaging	1.00
R1464:Rnf17	UTSW	14	56461911	missense	probably damaging	1.00
R1472:Rnf17	UTSW	14	56427979	missense	probably damaging	1.00
R1512:Rnf17	UTSW	14	56467786	missense	probably benign	0.01
R1605:Rnf17	UTSW	14	56493365	missense	probably damaging	1.00
R1778:Rnf17	UTSW	14	56522399	missense	probably damaging	0.99
R1791:Rnf17	UTSW	14	56504007	nonsense	probably null
R2023:Rnf17	UTSW	14	56431579	missense	possibly damaging	0.59
R2086:Rnf17	UTSW	14	56483380	missense	probably damaging	0.98
R2130:Rnf17	UTSW	14	56493354	missense	probably damaging	1.00
R2309:Rnf17	UTSW	14	56505982	missense	possibly damaging	0.95
R3003:Rnf17	UTSW	14	56500547	missense	probably damaging	1.00
R3611:Rnf17	UTSW	14	56467740	missense	probably benign	0.43
R3847:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3848:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3849:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3850:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3872:Rnf17	UTSW	14	56475413	missense	possibly damaging	0.89
R3874:Rnf17	UTSW	14	56475413	missense	possibly damaging	0.89
R4021:Rnf17	UTSW	14	56460001	missense	probably damaging	0.98
R4022:Rnf17	UTSW	14	56460001	missense	probably damaging	0.98
R4790:Rnf17	UTSW	14	56434355	missense	probably damaging	1.00
R4951:Rnf17	UTSW	14	56522391	missense	probably benign	0.02
R5068:Rnf17	UTSW	14	56505928	missense	probably damaging	0.99
R5069:Rnf17	UTSW	14	56505928	missense	probably damaging	0.99
R5070:Rnf17	UTSW	14	56505928	missense	probably damaging	0.99
R5518:Rnf17	UTSW	14	56482133	missense	probably damaging	1.00
R5628:Rnf17	UTSW	14	56486952	splice site	probably null
R5712:Rnf17	UTSW	14	56471399	missense	probably benign	0.19
R5747:Rnf17	UTSW	14	56465819	critical splice donor site	probably null
R5869:Rnf17	UTSW	14	56505988	missense	possibly damaging	0.94
R6336:Rnf17	UTSW	14	56421169	splice site	probably null
R6626:Rnf17	UTSW	14	56427924	missense	possibly damaging	0.92
R6639:Rnf17	UTSW	14	56438743	missense	probably benign	0.01
R6675:Rnf17	UTSW	14	56459975	missense	probably damaging	1.00
R6731:Rnf17	UTSW	14	56524350	missense	possibly damaging	0.93
R7062:Rnf17	UTSW	14	56465654	missense	probably benign	0.00
R7103:Rnf17	UTSW	14	56471306	missense	possibly damaging	0.63
R7144:Rnf17	UTSW	14	56512332	splice site	probably null
R7527:Rnf17	UTSW	14	56516438	missense	probably damaging	1.00
R7664:Rnf17	UTSW	14	56438878	missense	probably damaging	1.00
R7754:Rnf17	UTSW	14	56462072	critical splice donor site	probably null
R7772:Rnf17	UTSW	14	56477687	missense	probably benign	0.27
R8092:Rnf17	UTSW	14	56487022	missense	probably benign	0.00
R8150:Rnf17	UTSW	14	56421136	missense	probably benign	0.19
R8203:Rnf17	UTSW	14	56467722	missense	probably benign	0.17
R8320:Rnf17	UTSW	14	56424542	frame shift	probably null
R8321:Rnf17	UTSW	14	56424542	frame shift	probably null
R8379:Rnf17	UTSW	14	56424542	frame shift	probably null
R8380:Rnf17	UTSW	14	56424542	frame shift	probably null
R8381:Rnf17	UTSW	14	56424542	frame shift	probably null
R8382:Rnf17	UTSW	14	56424542	frame shift	probably null
R8383:Rnf17	UTSW	14	56424542	frame shift	probably null
R8799:Rnf17	UTSW	14	56500429	missense	probably damaging	1.00
R8850:Rnf17	UTSW	14	56485201	missense	probably damaging	1.00
R9212:Rnf17	UTSW	14	56524328	missense	probably damaging	1.00
R9276:Rnf17	UTSW	14	56482097	missense	probably damaging	1.00
R9300:Rnf17	UTSW	14	56460038	missense	possibly damaging	0.79
R9375:Rnf17	UTSW	14	56482122	missense	probably damaging	1.00
R9664:Rnf17	UTSW	14	56485179	missense	probably damaging	1.00
Z1177:Rnf17	UTSW	14	56467706	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- AGCTCAAACCTGACAAGTGAACTG -3'
(R):5'- GCAGCTCAGGTTTGAAAACACC -3'

Sequencing Primer
(F):5'- TTAAAAAGATTACCATGTCCGTCAG -3'
(R):5'- TCAGGTTTGAAAACACCCACAAAAG -3'

Posted On

2014-08-25