Mutagenetix > Incidental Mutations

Incidental Mutation 'R0140:Blnk'

22289

Institutional Source

Beutler Lab

Gene Symbol

Blnk

Ensembl Gene

ENSMUSG00000061132

Gene Name

B cell linker

Synonyms

BASH, Bca, SLP-65, BCA, BLNK, Ly-57, Ly57

MMRRC Submission

038425-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.148) question?

Stock #

R0140 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

40928927-40994535 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 40940224 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 285 (S285T)

Ref Sequence

ENSEMBL: ENSMUSP00000057844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054769] [ENSMUST00000117695]

AlphaFold

Q9QUN3

PDB Structure

Solution structure of the SH2 domain from mouse B-cell linker protein BLNK [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000054769
AA Change: S285T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000057844
Gene: ENSMUSG00000061132
AA Change: S285T

Domain	Start	End	E-Value	Type
Blast:SH2	139	180	6e-8	BLAST
low complexity region	235	247	N/A	INTRINSIC
low complexity region	251	266	N/A	INTRINSIC
SH2	345	436	3.07e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000117695
AA Change: S285T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112473
Gene: ENSMUSG00000061132
AA Change: S285T

Domain	Start	End	E-Value	Type
Blast:SH2	139	180	6e-8	BLAST
low complexity region	235	247	N/A	INTRINSIC
low complexity region	251	266	N/A	INTRINSIC
SH2	342	433	3.07e-19	SMART

Meta Mutation Damage Score

0.0935

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a partial block in pre-B cell development, a lack of B1 B cells, reduced numbers of mature B cells, lower IgM and IgG3 serum levels, poor IgM immune responses, and a high incidence of pre-B cell lymphoma. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,295,159		probably benign	Het
9330161L09Rik	T	C	12: 103,407,328		probably benign	Het
Abca2	T	G	2: 25,438,085		probably null	Het
Adgrf3	T	C	5: 30,196,381	K13R	probably benign	Het
Arhgap15	C	A	2: 44,322,767	F416L	probably damaging	Het
Arhgef26	C	G	3: 62,448,245	T746R	probably benign	Het
Aspm	C	T	1: 139,480,641	T2422I	probably benign	Het
Atp4a	C	G	7: 30,720,101	R659G	probably benign	Het
AY358078	T	A	14: 51,825,942	D348E	probably benign	Het
Calr3	C	T	8: 72,434,888		probably benign	Het
Camsap2	A	T	1: 136,280,382	V1124D	probably benign	Het
Ccdc40	G	A	11: 119,264,299	G1122S	probably benign	Het
Ccdc69	C	A	11: 55,050,499	C196F	possibly damaging	Het
Cdhr3	T	G	12: 33,080,413	N141T	probably benign	Het
Cdk4	T	C	10: 127,064,345	V37A	probably damaging	Het
Celsr2	C	T	3: 108,397,933	R2110K	probably benign	Het
Clcn7	A	G	17: 25,153,754	Y437C	probably damaging	Het
Col6a6	A	G	9: 105,702,275	F1917S	probably damaging	Het
Cps1	T	G	1: 67,180,116	S872A	probably benign	Het
Crebbp	G	T	16: 4,117,499	T842N	probably damaging	Het
Dennd2d	G	A	3: 106,492,483	V234I	probably benign	Het
Fam227b	T	C	2: 126,124,603	M130V	possibly damaging	Het
Fbxw24	G	T	9: 109,605,414	L373I	possibly damaging	Het
Fubp3	T	C	2: 31,608,184	Y359H	probably damaging	Het
Gm19684	T	C	17: 36,127,427		probably benign	Het
Hrnr	C	T	3: 93,331,493	Q3013*	probably null	Het
Il12rb1	T	C	8: 70,819,771		probably benign	Het
Lepr	A	T	4: 101,768,067	D473V	probably damaging	Het
Myof	A	T	19: 37,951,556	Y820*	probably null	Het
Nfil3	G	A	13: 52,967,645	Q408*	probably null	Het
Nolc1	G	A	19: 46,081,378		probably benign	Het
Npbwr1	A	C	1: 5,916,621	Y225D	probably damaging	Het
Nrip3	T	C	7: 109,761,815		probably benign	Het
Ntrk1	A	C	3: 87,778,568	L749R	probably damaging	Het
Olfr1115	A	G	2: 87,252,625	I229M	probably damaging	Het
Olfr1261	T	A	2: 89,994,119	V242D	probably damaging	Het
Olfr222	A	G	11: 59,570,978	L254P	probably damaging	Het
Olfr628	A	G	7: 103,732,142	D72G	probably damaging	Het
Olfr801	G	T	10: 129,669,688	T277N	probably damaging	Het
Paox	A	T	7: 140,134,058	T244S	probably damaging	Het
Pcdhb9	T	A	18: 37,402,961	D669E	possibly damaging	Het
Pggt1b	A	G	18: 46,258,083		probably null	Het
Phkg1	T	A	5: 129,864,608	I334F	probably benign	Het
Phtf1	A	T	3: 103,987,560	R208W	probably null	Het
Pnliprp2	A	T	19: 58,766,363	I280F	probably benign	Het
Pnmal1	A	G	7: 16,960,222	M1V	probably null	Het
Prcp	A	G	7: 92,928,611	T328A	probably damaging	Het
Pxdn	A	G	12: 29,982,754	E179G	probably benign	Het
Racgap1	A	T	15: 99,623,651	N541K	probably benign	Het
Rnf103	T	A	6: 71,509,331	F315L	possibly damaging	Het
Sept2	A	G	1: 93,501,639	R237G	probably damaging	Het
Setd6	T	A	8: 95,716,109	L58Q	probably damaging	Het
Sipa1l1	G	A	12: 82,396,200	V755I	probably damaging	Het
Slc16a12	G	T	19: 34,672,704		probably benign	Het
Slk	G	A	19: 47,622,335	D815N	probably damaging	Het
Stx1a	T	C	5: 135,045,585		probably benign	Het
Tbc1d15	T	A	10: 115,220,219	I283F	probably damaging	Het
Tenm4	T	C	7: 96,896,052	I2425T	possibly damaging	Het
Tle1	G	A	4: 72,120,185	H702Y	probably damaging	Het
Tmc6	A	G	11: 117,766,251		probably benign	Het
Tmem268	G	A	4: 63,577,859	R179H	possibly damaging	Het
Tmem9	A	G	1: 136,034,162	K165R	probably damaging	Het
Trpm6	A	G	19: 18,819,194		probably null	Het
Tufm	C	T	7: 126,489,831	P88S	probably damaging	Het
Ubqln1	A	G	13: 58,193,289	I216T	probably damaging	Het
Urad	T	G	5: 147,322,331	M1L	probably benign	Het
Utp6	A	G	11: 79,956,725		probably benign	Het
Vav2	C	T	2: 27,273,676		probably benign	Het
Vmn2r55	G	T	7: 12,668,177	Q395K	possibly damaging	Het
Wwox	T	G	8: 114,706,287	V231G	probably damaging	Het
Zfp646	T	A	7: 127,883,506	N1618K	probably benign	Het
Zzef1	G	A	11: 72,899,551	M2110I	possibly damaging	Het

Other mutations in Blnk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Blnk	APN	19	40934446	missense	probably benign	0.15
IGL01286:Blnk	APN	19	40934506	missense	probably benign	0.00
IGL02090:Blnk	APN	19	40934485	missense	probably benign	0.38
IGL02814:Blnk	APN	19	40962429	missense	probably damaging	1.00
IGL02831:Blnk	APN	19	40962429	missense	probably damaging	1.00
IGL03024:Blnk	APN	19	40994002	splice site	probably benign
Augen	UTSW	19	40929291	missense	probably damaging	1.00
Blick	UTSW	19	40934459	missense	probably damaging	1.00
busy	UTSW	19	40952391	nonsense	probably null
There	UTSW	19	40952390	missense	possibly damaging	0.94
IGL02988:Blnk	UTSW	19	40929216	missense	probably damaging	1.00
R0671:Blnk	UTSW	19	40937667	nonsense	probably null
R1617:Blnk	UTSW	19	40962363	missense	probably benign
R1638:Blnk	UTSW	19	40937678	missense	probably benign
R1803:Blnk	UTSW	19	40952377	missense	probably damaging	0.96
R1970:Blnk	UTSW	19	40940165	splice site	probably benign
R2880:Blnk	UTSW	19	40962455	missense	probably damaging	1.00
R2980:Blnk	UTSW	19	40962350	missense	probably damaging	1.00
R5421:Blnk	UTSW	19	40968523	missense	probably damaging	1.00
R5987:Blnk	UTSW	19	40929289	missense	possibly damaging	0.95
R6321:Blnk	UTSW	19	40934459	missense	probably damaging	1.00
R6703:Blnk	UTSW	19	40962506	splice site	probably null
R6970:Blnk	UTSW	19	40962377	missense	probably damaging	0.99
R7101:Blnk	UTSW	19	40972638	missense	probably benign	0.01
R7432:Blnk	UTSW	19	40959857	nonsense	probably null
R7560:Blnk	UTSW	19	40952390	missense	possibly damaging	0.94
R7797:Blnk	UTSW	19	40959788	missense	possibly damaging	0.51
R8287:Blnk	UTSW	19	40929291	missense	probably damaging	1.00
R8473:Blnk	UTSW	19	40952410	missense	possibly damaging	0.81
R8798:Blnk	UTSW	19	40962351	missense	probably damaging	1.00
R9094:Blnk	UTSW	19	40994039	missense	probably benign	0.39
R9139:Blnk	UTSW	19	40934518	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAACACCGATTCCCTGTGCGAG -3'
(R):5'- ATGGACCTGTACCACTGTGGGAAG -3'

Sequencing Primer
(F):5'- acagacagacagacaaacaaac -3'
(R):5'- AGGGAGTCTCGGTCCTAAG -3'

Posted On

2013-04-16