Mutagenetix > Incidental Mutations

Incidental Mutation 'R1988:Cntnap3'

222896

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

040000-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R1988 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64758390 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 801 (T801A)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: T801A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: T801A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222618

Meta Mutation Damage Score

0.1198

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.1%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	A	6: 146,952,896	D216V	possibly damaging	Het
2610021A01Rik	C	T	7: 41,626,657	R595*	probably null	Het
Adgrl3	A	G	5: 81,688,567	D724G	probably damaging	Het
Akap6	T	C	12: 53,140,795	F1664S	possibly damaging	Het
Akt1	T	C	12: 112,655,151	I404V	probably benign	Het
Anxa13	T	A	15: 58,341,948		noncoding transcript	Het
Atoh1	T	C	6: 64,729,633	V104A	probably benign	Het
Brwd1	T	C	16: 96,021,237	D1256G	probably damaging	Het
C9	ATTTT	ATTT	15: 6,483,138		probably null	Het
Cd164	A	G	10: 41,523,181	T89A	probably benign	Het
Cep350	G	C	1: 155,933,104	N575K	possibly damaging	Het
Chrm5	A	G	2: 112,480,252	V173A	probably damaging	Het
Cnot1	A	G	8: 95,741,944	V1417A	possibly damaging	Het
Cntnap5b	A	C	1: 100,072,140	K208Q	possibly damaging	Het
Crx	A	T	7: 15,869,347	V107D	possibly damaging	Het
Csrnp2	A	G	15: 100,489,440	F49S	probably damaging	Het
Ctbp1	A	G	5: 33,250,904	L228P	possibly damaging	Het
Ctdp1	A	T	18: 80,449,401	D626E	possibly damaging	Het
Cyp1a2	T	C	9: 57,682,286	T82A	possibly damaging	Het
Dnah3	T	A	7: 119,967,570	T2478S	possibly damaging	Het
Dnah3	T	G	7: 119,967,959	D2348A	probably damaging	Het
Dnah5	T	C	15: 28,343,591	I2379T	probably damaging	Het
Dnah6	A	G	6: 73,092,192	I2504T	probably damaging	Het
Dnase1l2	A	C	17: 24,441,651	W138G	probably damaging	Het
Dopey2	T	A	16: 93,766,173	I855N	probably damaging	Het
Dsc3	T	A	18: 19,965,846	N759Y	possibly damaging	Het
Dtx2	C	T	5: 136,032,293	R510*	probably null	Het
Fat4	G	T	3: 38,887,115	M52I	probably benign	Het
Fat4	G	A	3: 38,996,090	E4034K	probably damaging	Het
Fezf2	T	C	14: 12,344,350	K279R	probably damaging	Het
Fsip2	G	T	2: 82,976,517	W1060L	possibly damaging	Het
G6pc	T	A	11: 101,367,942	I49N	probably damaging	Het
Gars	A	G	6: 55,077,772	E688G	probably null	Het
Gdf11	T	C	10: 128,885,242	N361S	probably benign	Het
Gli3	A	C	13: 15,726,380	M1451L	probably benign	Het
Heatr3	T	C	8: 88,150,317	I329T	probably benign	Het
Herc3	T	G	6: 58,884,975		probably null	Het
Hrnr	A	G	3: 93,332,604	N3383S	unknown	Het
Igsf3	A	T	3: 101,431,296	I309F	probably benign	Het
Kif21b	C	T	1: 136,152,264	R513W	probably damaging	Het
Kif7	G	T	7: 79,699,241	H1195Q	probably benign	Het
Lpcat4	T	C	2: 112,242,542	V182A	possibly damaging	Het
Map3k21	T	A	8: 125,927,555	I371N	probably benign	Het
Mns1	G	A	9: 72,448,759		probably null	Het
Myo3a	A	G	2: 22,578,128	T465A	possibly damaging	Het
Nlrc4	A	T	17: 74,426,943	S992T	probably benign	Het
Notch4	G	A	17: 34,587,588	G1833E	possibly damaging	Het
Olfr160	A	T	9: 37,711,697	I194K	possibly damaging	Het
Olfr467	A	T	7: 107,814,700	I39L	probably benign	Het
Olfr600	T	A	7: 103,346,109	Y273F	possibly damaging	Het
Olfr666	T	C	7: 104,892,903	T242A	probably damaging	Het
Olfr998	G	A	2: 85,590,641	V34I	probably benign	Het
Pcdh9	G	A	14: 93,888,305	P143L	probably damaging	Het
Pik3cd	T	A	4: 149,663,203	T28S	probably damaging	Het
Pkd1	G	T	17: 24,576,592		probably null	Het
Plk4	A	T	3: 40,805,817	S383C	possibly damaging	Het
Plxna2	T	C	1: 194,643,989	L77P	probably damaging	Het
Ppm1f	T	C	16: 16,923,666	S335P	probably damaging	Het
Prr16	C	T	18: 51,303,277	P276L	probably damaging	Het
Rilp	A	G	11: 75,510,933		probably null	Het
Rspry1	A	G	8: 94,632,054		probably null	Het
Serpinb9b	T	C	13: 33,029,559	V33A	probably benign	Het
Slc4a10	C	A	2: 62,268,204	Q561K	probably damaging	Het
Smyd5	T	C	6: 85,438,136	I42T	possibly damaging	Het
Stk17b	T	C	1: 53,761,082	N246D	probably damaging	Het
Suco	T	C	1: 161,818,811		probably null	Het
Tcrg-C3	C	A	13: 19,260,994	F37L	probably damaging	Het
Tecpr1	C	T	5: 144,204,697	V785M	possibly damaging	Het
Telo2	C	T	17: 25,101,668	V756I	probably benign	Het
Tgm1	C	T	14: 55,705,577	R602H	probably benign	Het
Timeless	A	G	10: 128,244,187	T402A	probably damaging	Het
Tnfaip2	T	A	12: 111,449,891		probably null	Het
Trim5	A	G	7: 104,265,621	S414P	probably damaging	Het
Txnip	A	G	3: 96,559,750	T247A	possibly damaging	Het
Vmn1r174	A	T	7: 23,754,625	T239S	probably damaging	Het
Vmn1r231	T	A	17: 20,889,950	E234D	probably damaging	Het
Zranb3	A	T	1: 127,959,743	N982K	probably benign	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAGTATCTCAAGACTCGGGTC -3'
(R):5'- GTTTCTTCTGAAAATCAAGACACCC -3'

Sequencing Primer
(F):5'- TATCTCAAGACTCGGGTCAGGATC -3'
(R):5'- TAGGTAAGTAGCCATACCCTCTG -3'

Posted On

2014-08-25