Mutagenetix > Incidental Mutation

Incidental Mutation 'R1988:Tgm1'

222902

Institutional Source

Beutler Lab

Gene Symbol

Tgm1

Ensembl Gene

ENSMUSG00000022218

Gene Name

transglutaminase 1, K polypeptide

Synonyms

TG K, TGase 1, protein-glutamine-gamma-glutamyltransferase, K polypeptide, 2310004J08Rik

MMRRC Submission

040000-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.926) question?

Stock #

R1988 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55700009-55713926 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 55705577 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 602 (R602H)

Ref Sequence

ENSEMBL: ENSMUSP00000137642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002389] [ENSMUST00000168729] [ENSMUST00000178034]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000002389
AA Change: R602H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000002389
Gene: ENSMUSG00000022218
AA Change: R602H

Domain	Start	End	E-Value	Type
low complexity region	13	45	N/A	INTRINSIC
low complexity region	50	63	N/A	INTRINSIC
low complexity region	65	95	N/A	INTRINSIC
Pfam:Transglut_N	109	228	5.5e-35	PFAM
TGc	368	461	1.7e-43	SMART
low complexity region	550	561	N/A	INTRINSIC
Pfam:Transglut_C	578	682	1.5e-22	PFAM
Pfam:Transglut_C	690	787	1e-20	PFAM
low complexity region	788	804	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168729
AA Change: R602H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000128090
Gene: ENSMUSG00000022218
AA Change: R602H

Domain	Start	End	E-Value	Type
low complexity region	13	45	N/A	INTRINSIC
low complexity region	50	63	N/A	INTRINSIC
low complexity region	65	95	N/A	INTRINSIC
Pfam:Transglut_N	109	228	5.5e-35	PFAM
TGc	368	461	1.7e-43	SMART
low complexity region	550	561	N/A	INTRINSIC
Pfam:Transglut_C	578	682	1.5e-22	PFAM
Pfam:Transglut_C	690	787	1e-20	PFAM
low complexity region	788	804	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178034
AA Change: R602H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000137642
Gene: ENSMUSG00000022218
AA Change: R602H

Domain	Start	End	E-Value	Type
low complexity region	13	45	N/A	INTRINSIC
low complexity region	50	63	N/A	INTRINSIC
low complexity region	65	95	N/A	INTRINSIC
Pfam:Transglut_N	110	226	1.2e-32	PFAM
TGc	368	461	1.7e-43	SMART
low complexity region	550	561	N/A	INTRINSIC
Pfam:Transglut_C	578	682	3.6e-24	PFAM
Pfam:Transglut_C	690	787	1.3e-20	PFAM
low complexity region	788	804	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227106

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.1%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that catalyzes the addition of an alkyl group from an akylamine to a glutamine residue of a protein, forming an alkylglutamine in the protein. This protein alkylation leads to crosslinking of proteins and catenation of polyamines to proteins. This gene contains either one or two copies of a 22 nt repeat unit in its 3' UTR. Mutations in this gene have been associated with autosomal recessive lamellar ichthyosis (LI) and nonbullous congenital ichthyosiform erythroderma (NCIE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele are small and hypoactive and die within hours of birth displaying failure to suckle, progressive dehydration, and epidermal defects including a reddish, tight and wrinkled skin, hyperkeratosis, and impaired skin barrier function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	A	6: 146,952,896	D216V	possibly damaging	Het
2610021A01Rik	C	T	7: 41,626,657	R595*	probably null	Het
Adgrl3	A	G	5: 81,688,567	D724G	probably damaging	Het
Akap6	T	C	12: 53,140,795	F1664S	possibly damaging	Het
Akt1	T	C	12: 112,655,151	I404V	probably benign	Het
Anxa13	T	A	15: 58,341,948		noncoding transcript	Het
Atoh1	T	C	6: 64,729,633	V104A	probably benign	Het
Brwd1	T	C	16: 96,021,237	D1256G	probably damaging	Het
C9	ATTTT	ATTT	15: 6,483,138		probably null	Het
Cd164	A	G	10: 41,523,181	T89A	probably benign	Het
Cep350	G	C	1: 155,933,104	N575K	possibly damaging	Het
Chrm5	A	G	2: 112,480,252	V173A	probably damaging	Het
Cnot1	A	G	8: 95,741,944	V1417A	possibly damaging	Het
Cntnap3	T	C	13: 64,758,390	T801A	probably damaging	Het
Cntnap5b	A	C	1: 100,072,140	K208Q	possibly damaging	Het
Crx	A	T	7: 15,869,347	V107D	possibly damaging	Het
Csrnp2	A	G	15: 100,489,440	F49S	probably damaging	Het
Ctbp1	A	G	5: 33,250,904	L228P	possibly damaging	Het
Ctdp1	A	T	18: 80,449,401	D626E	possibly damaging	Het
Cyp1a2	T	C	9: 57,682,286	T82A	possibly damaging	Het
Dnah3	T	A	7: 119,967,570	T2478S	possibly damaging	Het
Dnah3	T	G	7: 119,967,959	D2348A	probably damaging	Het
Dnah5	T	C	15: 28,343,591	I2379T	probably damaging	Het
Dnah6	A	G	6: 73,092,192	I2504T	probably damaging	Het
Dnase1l2	A	C	17: 24,441,651	W138G	probably damaging	Het
Dopey2	T	A	16: 93,766,173	I855N	probably damaging	Het
Dsc3	T	A	18: 19,965,846	N759Y	possibly damaging	Het
Dtx2	C	T	5: 136,032,293	R510*	probably null	Het
Fat4	G	T	3: 38,887,115	M52I	probably benign	Het
Fat4	G	A	3: 38,996,090	E4034K	probably damaging	Het
Fezf2	T	C	14: 12,344,350	K279R	probably damaging	Het
Fsip2	G	T	2: 82,976,517	W1060L	possibly damaging	Het
G6pc	T	A	11: 101,367,942	I49N	probably damaging	Het
Gars	A	G	6: 55,077,772	E688G	probably null	Het
Gdf11	T	C	10: 128,885,242	N361S	probably benign	Het
Gli3	A	C	13: 15,726,380	M1451L	probably benign	Het
Heatr3	T	C	8: 88,150,317	I329T	probably benign	Het
Herc3	T	G	6: 58,884,975		probably null	Het
Hrnr	A	G	3: 93,332,604	N3383S	unknown	Het
Igsf3	A	T	3: 101,431,296	I309F	probably benign	Het
Kif21b	C	T	1: 136,152,264	R513W	probably damaging	Het
Kif7	G	T	7: 79,699,241	H1195Q	probably benign	Het
Lpcat4	T	C	2: 112,242,542	V182A	possibly damaging	Het
Map3k21	T	A	8: 125,927,555	I371N	probably benign	Het
Mns1	G	A	9: 72,448,759		probably null	Het
Myo3a	A	G	2: 22,578,128	T465A	possibly damaging	Het
Nlrc4	A	T	17: 74,426,943	S992T	probably benign	Het
Notch4	G	A	17: 34,587,588	G1833E	possibly damaging	Het
Olfr160	A	T	9: 37,711,697	I194K	possibly damaging	Het
Olfr467	A	T	7: 107,814,700	I39L	probably benign	Het
Olfr600	T	A	7: 103,346,109	Y273F	possibly damaging	Het
Olfr666	T	C	7: 104,892,903	T242A	probably damaging	Het
Olfr998	G	A	2: 85,590,641	V34I	probably benign	Het
Pcdh9	G	A	14: 93,888,305	P143L	probably damaging	Het
Pik3cd	T	A	4: 149,663,203	T28S	probably damaging	Het
Pkd1	G	T	17: 24,576,592		probably null	Het
Plk4	A	T	3: 40,805,817	S383C	possibly damaging	Het
Plxna2	T	C	1: 194,643,989	L77P	probably damaging	Het
Ppm1f	T	C	16: 16,923,666	S335P	probably damaging	Het
Prr16	C	T	18: 51,303,277	P276L	probably damaging	Het
Rilp	A	G	11: 75,510,933		probably null	Het
Rspry1	A	G	8: 94,632,054		probably null	Het
Serpinb9b	T	C	13: 33,029,559	V33A	probably benign	Het
Slc4a10	C	A	2: 62,268,204	Q561K	probably damaging	Het
Smyd5	T	C	6: 85,438,136	I42T	possibly damaging	Het
Stk17b	T	C	1: 53,761,082	N246D	probably damaging	Het
Suco	T	C	1: 161,818,811		probably null	Het
Tcrg-C3	C	A	13: 19,260,994	F37L	probably damaging	Het
Tecpr1	C	T	5: 144,204,697	V785M	possibly damaging	Het
Telo2	C	T	17: 25,101,668	V756I	probably benign	Het
Timeless	A	G	10: 128,244,187	T402A	probably damaging	Het
Tnfaip2	T	A	12: 111,449,891		probably null	Het
Trim5	A	G	7: 104,265,621	S414P	probably damaging	Het
Txnip	A	G	3: 96,559,750	T247A	possibly damaging	Het
Vmn1r174	A	T	7: 23,754,625	T239S	probably damaging	Het
Vmn1r231	T	A	17: 20,889,950	E234D	probably damaging	Het
Zranb3	A	T	1: 127,959,743	N982K	probably benign	Het

Other mutations in Tgm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02206:Tgm1	APN	14	55704935	missense	possibly damaging	0.92
IGL02934:Tgm1	APN	14	55709989	missense	probably damaging	1.00
IGL03243:Tgm1	APN	14	55705907	missense	probably damaging	0.98
IGL03282:Tgm1	APN	14	55711070	missense	probably damaging	1.00
PIT4458001:Tgm1	UTSW	14	55712565	missense	unknown
R0277:Tgm1	UTSW	14	55710927	unclassified	probably benign
R0277:Tgm1	UTSW	14	55712652	unclassified	probably benign
R0478:Tgm1	UTSW	14	55700334	nonsense	probably null
R1349:Tgm1	UTSW	14	55711201	unclassified	probably benign
R1594:Tgm1	UTSW	14	55709519	missense	probably damaging	0.96
R1776:Tgm1	UTSW	14	55709397	missense	probably damaging	0.99
R1852:Tgm1	UTSW	14	55704941	missense	probably damaging	1.00
R2064:Tgm1	UTSW	14	55709471	missense	probably damaging	1.00
R2139:Tgm1	UTSW	14	55709543	missense	probably damaging	1.00
R2427:Tgm1	UTSW	14	55712100	critical splice donor site	probably null
R3710:Tgm1	UTSW	14	55712595	unclassified	probably benign
R3917:Tgm1	UTSW	14	55712757	splice site	probably benign
R4697:Tgm1	UTSW	14	55705681	missense	probably benign	0.05
R4804:Tgm1	UTSW	14	55705619	missense	probably benign	0.38
R5074:Tgm1	UTSW	14	55709935	missense	probably damaging	1.00
R5341:Tgm1	UTSW	14	55700248	missense	possibly damaging	0.90
R5346:Tgm1	UTSW	14	55711172	missense	probably damaging	0.99
R5557:Tgm1	UTSW	14	55705643	missense	probably benign	0.10
R5566:Tgm1	UTSW	14	55712436	missense	probably damaging	0.99
R5828:Tgm1	UTSW	14	55705554	missense	probably benign	0.38
R6802:Tgm1	UTSW	14	55712482	unclassified	probably benign
R7017:Tgm1	UTSW	14	55704941	missense	possibly damaging	0.76
R7094:Tgm1	UTSW	14	55704843	missense	possibly damaging	0.53
R7549:Tgm1	UTSW	14	55705903	missense	probably benign	0.02
R7731:Tgm1	UTSW	14	55710521	missense	probably benign	0.21
R7799:Tgm1	UTSW	14	55712475	missense	unknown
R7915:Tgm1	UTSW	14	55700426	missense	probably damaging	0.98
R7956:Tgm1	UTSW	14	55708895	missense	probably benign	0.01
R8098:Tgm1	UTSW	14	55710534	missense	probably damaging	1.00
R8190:Tgm1	UTSW	14	55704884	missense	probably damaging	1.00
R8423:Tgm1	UTSW	14	55705643	missense	probably benign	0.35
R8493:Tgm1	UTSW	14	55700297	missense	probably damaging	1.00
R8859:Tgm1	UTSW	14	55712229	missense	probably benign	0.01
R9170:Tgm1	UTSW	14	55708898	missense	probably damaging	1.00
R9300:Tgm1	UTSW	14	55704846	missense	probably benign	0.05
R9365:Tgm1	UTSW	14	55704892	missense	probably damaging	0.96
R9407:Tgm1	UTSW	14	55705534	nonsense	probably null
R9499:Tgm1	UTSW	14	55713476	start gained	probably benign
R9520:Tgm1	UTSW	14	55704839	missense	probably damaging	1.00
R9552:Tgm1	UTSW	14	55713476	start gained	probably benign
R9664:Tgm1	UTSW	14	55710984	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCATCTAGGGACAGTGCTG -3'
(R):5'- AGAGCTCAAACGCACCTTTGAC -3'

Sequencing Primer
(F):5'- ACCATTTAGGGGCAGGGCTG -3'
(R):5'- TTTGACCTCAACCCCCAGG -3'

Posted On

2014-08-25