Incidental Mutation 'R2015:Lnpep'
ID 222915
Institutional Source Beutler Lab
Gene Symbol Lnpep
Ensembl Gene ENSMUSG00000023845
Gene Name leucyl/cystinyl aminopeptidase
Synonyms IRAP, 4732490P18Rik, 2010309L07Rik, gp160, vp165
MMRRC Submission 040024-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2015 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 17747985-17846303 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 17799325 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 110 (T110I)
Ref Sequence ENSEMBL: ENSMUSP00000036998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041047]
AlphaFold Q8C129
Predicted Effect probably damaging
Transcript: ENSMUST00000041047
AA Change: T110I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036998
Gene: ENSMUSG00000023845
AA Change: T110I

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Peptidase_M1 167 552 9.2e-143 PFAM
Pfam:ERAP1_C 689 1007 1e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232515
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent aminopeptidase that cleaves vasopressin, oxytocin, lys-bradykinin, met-enkephalin, dynorphin A and other peptide hormones. The protein can be secreted in maternal serum, reside in intracellular vesicles with the insulin-responsive glucose transporter GLUT4, or form a type II integral membrane glycoprotein. The protein catalyzes the final step in the conversion of angiotensinogen to angiotensin IV (AT4) and is also a receptor for AT4. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a somewhat reduced tissue uptake of glucose either basally or after insulin stimulation. Mice homozygous for a different knock-out allele exhibit impaired coordination at 3 months and impaired spatial working memory in a Y maze at 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,022,672 (GRCm39) M1022K probably benign Het
Abhd4 T A 14: 54,500,289 (GRCm39) H74Q probably damaging Het
Actg1 A G 11: 120,237,636 (GRCm39) S49P possibly damaging Het
Adcy8 C T 15: 64,639,727 (GRCm39) G678S probably benign Het
Aire T C 10: 77,878,792 (GRCm39) D85G probably damaging Het
Akr1c18 T A 13: 4,195,308 (GRCm39) D50V probably damaging Het
Ankrd13a C A 5: 114,930,170 (GRCm39) A185E probably damaging Het
Apc A G 18: 34,448,644 (GRCm39) I1813V probably damaging Het
Armc8 A T 9: 99,365,158 (GRCm39) C661* probably null Het
Bbs10 C T 10: 111,136,716 (GRCm39) Q610* probably null Het
Blm T C 7: 80,152,147 (GRCm39) E600G probably damaging Het
Bpifb9a T C 2: 154,110,120 (GRCm39) probably null Het
Cdk14 T C 5: 5,430,082 (GRCm39) K15R probably benign Het
Cdr1 A G X: 60,228,420 (GRCm39) F249L probably benign Het
Cep250 A C 2: 155,823,373 (GRCm39) H1009P probably damaging Het
Cfap97d1 C A 11: 101,878,044 (GRCm39) H35Q probably damaging Het
Clasp2 A G 9: 113,740,568 (GRCm39) T495A possibly damaging Het
Col19a1 C G 1: 24,598,834 (GRCm39) G53A unknown Het
Cpne1 G A 2: 155,920,308 (GRCm39) R166C probably damaging Het
Dtx3l G A 16: 35,756,797 (GRCm39) H129Y probably benign Het
Ercc3 A G 18: 32,381,482 (GRCm39) T433A probably benign Het
Gm9936 T A 5: 114,995,482 (GRCm39) probably benign Het
Grina T C 15: 76,132,734 (GRCm39) V167A probably damaging Het
H2ac25 T A 11: 58,845,754 (GRCm39) L64Q probably damaging Het
Hcfc2 A G 10: 82,574,814 (GRCm39) N618D probably benign Het
Herpud1 T C 8: 95,118,834 (GRCm39) V196A probably benign Het
Hlcs A G 16: 94,063,599 (GRCm39) V487A probably benign Het
Hspa9 A T 18: 35,079,701 (GRCm39) Y243N probably damaging Het
Igll1 A G 16: 16,681,639 (GRCm39) S39P probably benign Het
Kdm5a T C 6: 120,408,951 (GRCm39) S1545P probably benign Het
Klra8 C A 6: 130,092,536 (GRCm39) C255F probably damaging Het
Krtap4-6 A T 11: 99,556,398 (GRCm39) C110S unknown Het
Lef1 T A 3: 130,905,236 (GRCm39) I39N probably damaging Het
Lrp1 T A 10: 127,376,563 (GRCm39) T4282S probably benign Het
Lrp6 A G 6: 134,457,337 (GRCm39) probably null Het
Ly6g5b A C 17: 35,333,654 (GRCm39) S53A possibly damaging Het
M6pr T G 6: 122,290,332 (GRCm39) N98K probably damaging Het
Mal2 T C 15: 54,464,136 (GRCm39) *176Q probably null Het
Mansc1 T C 6: 134,587,274 (GRCm39) D301G possibly damaging Het
Marchf1 C A 8: 66,574,473 (GRCm39) N11K probably damaging Het
Mast3 T A 8: 71,240,007 (GRCm39) I338F probably benign Het
Mcm3 A G 1: 20,873,804 (GRCm39) L772P probably damaging Het
Mib2 C T 4: 155,742,337 (GRCm39) G176D probably damaging Het
Mier2 A T 10: 79,377,036 (GRCm39) probably null Het
Mogs C T 6: 83,094,631 (GRCm39) R483* probably null Het
Msl2 G T 9: 100,957,304 (GRCm39) probably benign Het
Naa16 A T 14: 79,582,499 (GRCm39) M530K probably damaging Het
Nde1 A T 16: 13,987,321 (GRCm39) probably benign Het
Ndufb10 T C 17: 24,941,503 (GRCm39) probably null Het
Nhsl1 A T 10: 18,387,340 (GRCm39) R205W probably damaging Het
Npffr2 T A 5: 89,730,751 (GRCm39) I227N probably damaging Het
Nup210l T A 3: 90,092,739 (GRCm39) L1231Q probably damaging Het
Or2f1 A G 6: 42,721,784 (GRCm39) E271G probably damaging Het
Or7a39 T C 10: 78,715,222 (GRCm39) I72T possibly damaging Het
Pclo C A 5: 14,571,515 (GRCm39) P300Q probably damaging Het
Pik3c2a T A 7: 115,950,166 (GRCm39) probably null Het
Plekha5 T A 6: 140,480,290 (GRCm39) probably null Het
Pls1 A G 9: 95,643,418 (GRCm39) V527A possibly damaging Het
Ppfia2 T C 10: 106,310,538 (GRCm39) M15T probably benign Het
Prkd2 T A 7: 16,581,602 (GRCm39) C152* probably null Het
Ptprq T G 10: 107,503,283 (GRCm39) K792Q probably damaging Het
Pttg1ip2 T A 5: 5,505,964 (GRCm39) I106L probably benign Het
Rbbp8 T C 18: 11,853,681 (GRCm39) M296T probably benign Het
Rfc3 T C 5: 151,571,003 (GRCm39) probably null Het
Rnf17 A G 14: 56,724,426 (GRCm39) N1090S probably benign Het
Sash1 A T 10: 8,605,177 (GRCm39) V1071D probably benign Het
Sdsl G A 5: 120,601,218 (GRCm39) T18M probably damaging Het
Sepsecs T A 5: 52,804,966 (GRCm39) Q365L probably benign Het
Sgta A T 10: 80,887,130 (GRCm39) V45E probably damaging Het
Slc25a46 A T 18: 31,742,778 (GRCm39) H29Q probably benign Het
Slc2a8 A C 2: 32,871,392 (GRCm39) V136G probably benign Het
Smg7 A T 1: 152,736,259 (GRCm39) N166K probably damaging Het
Spata21 C T 4: 140,834,640 (GRCm39) Q505* probably null Het
Strn4 T C 7: 16,566,953 (GRCm39) S458P possibly damaging Het
Tbc1d22a C T 15: 86,183,885 (GRCm39) T248M probably damaging Het
Trabd T A 15: 88,968,929 (GRCm39) M149K possibly damaging Het
Trpv3 A T 11: 73,170,653 (GRCm39) N178Y probably damaging Het
Try5 C T 6: 41,291,585 (GRCm39) probably null Het
Tsg101 C T 7: 46,558,652 (GRCm39) probably null Het
Ube3b A G 5: 114,549,210 (GRCm39) E738G probably damaging Het
Unc13d A G 11: 115,959,581 (GRCm39) S631P probably damaging Het
Unc5d T C 8: 29,249,007 (GRCm39) T297A probably damaging Het
Usp18 A T 6: 121,245,509 (GRCm39) E1V probably damaging Het
Vapb C A 2: 173,613,391 (GRCm39) P97T probably benign Het
Vmn1r33 T A 6: 66,589,356 (GRCm39) D66V probably benign Het
Vmn2r19 T A 6: 123,292,954 (GRCm39) M332K probably benign Het
Vmn2r71 T A 7: 85,269,845 (GRCm39) M452K probably benign Het
Vps13b T C 15: 35,607,288 (GRCm39) S1074P probably damaging Het
Vwde C A 6: 13,208,337 (GRCm39) G182C possibly damaging Het
Wdfy3 A C 5: 102,008,352 (GRCm39) S2778A probably null Het
Zbtb2 T A 10: 4,319,757 (GRCm39) I90F possibly damaging Het
Zfp518b C A 5: 38,829,345 (GRCm39) V887F probably benign Het
Zfp790 A G 7: 29,528,286 (GRCm39) T324A probably benign Het
Zup1 A G 10: 33,805,820 (GRCm39) V437A possibly damaging Het
Other mutations in Lnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01983:Lnpep APN 17 17,751,440 (GRCm39) missense probably damaging 1.00
IGL02008:Lnpep APN 17 17,791,219 (GRCm39) missense probably benign 0.40
IGL02040:Lnpep APN 17 17,765,167 (GRCm39) missense probably benign 0.13
IGL02392:Lnpep APN 17 17,799,445 (GRCm39) missense possibly damaging 0.48
IGL02417:Lnpep APN 17 17,765,165 (GRCm39) missense possibly damaging 0.57
IGL02659:Lnpep APN 17 17,791,162 (GRCm39) missense possibly damaging 0.83
IGL02697:Lnpep APN 17 17,773,455 (GRCm39) missense probably benign
IGL02947:Lnpep APN 17 17,791,234 (GRCm39) missense probably damaging 1.00
IGL03493:Lnpep APN 17 17,799,433 (GRCm39) missense probably damaging 1.00
I0000:Lnpep UTSW 17 17,799,233 (GRCm39) missense probably damaging 1.00
PIT4504001:Lnpep UTSW 17 17,799,289 (GRCm39) missense probably benign 0.00
R0528:Lnpep UTSW 17 17,751,394 (GRCm39) splice site probably benign
R0535:Lnpep UTSW 17 17,791,935 (GRCm39) missense possibly damaging 0.91
R0540:Lnpep UTSW 17 17,758,816 (GRCm39) missense probably damaging 1.00
R0586:Lnpep UTSW 17 17,795,658 (GRCm39) splice site probably benign
R0607:Lnpep UTSW 17 17,758,816 (GRCm39) missense probably damaging 1.00
R1502:Lnpep UTSW 17 17,791,906 (GRCm39) missense probably damaging 1.00
R1570:Lnpep UTSW 17 17,799,418 (GRCm39) missense probably damaging 1.00
R1733:Lnpep UTSW 17 17,773,575 (GRCm39) missense probably benign 0.00
R1826:Lnpep UTSW 17 17,783,098 (GRCm39) missense probably damaging 1.00
R2029:Lnpep UTSW 17 17,788,661 (GRCm39) missense probably damaging 1.00
R4593:Lnpep UTSW 17 17,799,289 (GRCm39) missense probably benign 0.00
R4638:Lnpep UTSW 17 17,795,569 (GRCm39) missense probably damaging 1.00
R4741:Lnpep UTSW 17 17,791,920 (GRCm39) missense probably damaging 1.00
R4919:Lnpep UTSW 17 17,799,173 (GRCm39) missense probably damaging 1.00
R5030:Lnpep UTSW 17 17,799,571 (GRCm39) missense probably damaging 1.00
R5111:Lnpep UTSW 17 17,798,872 (GRCm39) missense possibly damaging 0.93
R5203:Lnpep UTSW 17 17,757,325 (GRCm39) missense probably damaging 1.00
R5320:Lnpep UTSW 17 17,766,727 (GRCm39) missense possibly damaging 0.83
R5419:Lnpep UTSW 17 17,786,992 (GRCm39) missense probably damaging 1.00
R5535:Lnpep UTSW 17 17,758,956 (GRCm39) missense probably benign 0.02
R5680:Lnpep UTSW 17 17,799,444 (GRCm39) nonsense probably null
R6134:Lnpep UTSW 17 17,773,454 (GRCm39) missense probably benign
R6142:Lnpep UTSW 17 17,786,943 (GRCm39) critical splice donor site probably null
R6189:Lnpep UTSW 17 17,787,001 (GRCm39) missense possibly damaging 0.46
R6225:Lnpep UTSW 17 17,799,245 (GRCm39) missense possibly damaging 0.66
R6350:Lnpep UTSW 17 17,783,071 (GRCm39) missense probably benign 0.01
R6357:Lnpep UTSW 17 17,773,176 (GRCm39) missense probably benign 0.00
R6765:Lnpep UTSW 17 17,750,758 (GRCm39) missense probably damaging 1.00
R6794:Lnpep UTSW 17 17,751,421 (GRCm39) missense probably damaging 1.00
R7013:Lnpep UTSW 17 17,788,625 (GRCm39) missense probably benign 0.04
R7208:Lnpep UTSW 17 17,773,172 (GRCm39) nonsense probably null
R7268:Lnpep UTSW 17 17,758,803 (GRCm39) missense probably benign
R7564:Lnpep UTSW 17 17,798,854 (GRCm39) missense probably benign 0.22
R7746:Lnpep UTSW 17 17,758,824 (GRCm39) missense probably benign
R7853:Lnpep UTSW 17 17,783,109 (GRCm39) missense probably benign 0.00
R7881:Lnpep UTSW 17 17,787,001 (GRCm39) missense probably benign 0.01
R8015:Lnpep UTSW 17 17,766,761 (GRCm39) missense probably damaging 1.00
R8070:Lnpep UTSW 17 17,758,900 (GRCm39) missense probably damaging 1.00
R8835:Lnpep UTSW 17 17,750,118 (GRCm39) missense possibly damaging 0.81
R8843:Lnpep UTSW 17 17,773,203 (GRCm39) missense probably damaging 1.00
R9136:Lnpep UTSW 17 17,750,090 (GRCm39) missense probably benign 0.26
R9274:Lnpep UTSW 17 17,758,837 (GRCm39) missense probably benign 0.01
R9427:Lnpep UTSW 17 17,795,609 (GRCm39) missense probably benign 0.08
R9789:Lnpep UTSW 17 17,795,596 (GRCm39) missense probably damaging 1.00
X0004:Lnpep UTSW 17 17,765,074 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGGGAAGCCTAATTTGAGC -3'
(R):5'- TCCTCTGGAACCCGATGAAGTG -3'

Sequencing Primer
(F):5'- AGCCTAATTTGAGCCCATGG -3'
(R):5'- TGGAATATGAGCCCCGAGGTTC -3'
Posted On 2014-08-25