Mutagenetix > Incidental Mutation

Incidental Mutation 'R1988:Dsc3'

222930

Institutional Source

Beutler Lab

Gene Symbol

Dsc3

Ensembl Gene

ENSMUSG00000059898

Gene Name

desmocollin 3

Synonyms

MMRRC Submission

040000-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1988 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19960930-20002351 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19965846 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 759 (N759Y)

Ref Sequence

ENSEMBL: ENSMUSP00000153261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115848] [ENSMUST00000225110]

AlphaFold

P55850

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115848
AA Change: N759Y

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000111514
Gene: ENSMUSG00000059898
AA Change: N759Y

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	9.08e-41	SMART
CA	156	241	4.99e-11	SMART
CA	265	353	7.79e-22	SMART
CA	376	471	2.66e-6	SMART
CA	494	576	4.58e-19	SMART
CA	595	677	3.02e-2	SMART
transmembrane domain	692	714	N/A	INTRINSIC
Pfam:Cadherin_C	778	895	1.1e-8	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225110
AA Change: N759Y

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

Meta Mutation Damage Score

0.0909

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.1%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. Together with desmogleins, the encoded protein forms the transmembrane core of desmosomes, a multiprotein complex involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. Mice lacking the encoded protein exhibit a pre-implantation lethal phenotype. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die before implantation. Heterozygous mice do not display any gross abnormalities and have normal epidermal development and keratinocyte differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	A	6: 146,952,896	D216V	possibly damaging	Het
2610021A01Rik	C	T	7: 41,626,657	R595*	probably null	Het
Adgrl3	A	G	5: 81,688,567	D724G	probably damaging	Het
Akap6	T	C	12: 53,140,795	F1664S	possibly damaging	Het
Akt1	T	C	12: 112,655,151	I404V	probably benign	Het
Anxa13	T	A	15: 58,341,948		noncoding transcript	Het
Atoh1	T	C	6: 64,729,633	V104A	probably benign	Het
Brwd1	T	C	16: 96,021,237	D1256G	probably damaging	Het
C9	ATTTT	ATTT	15: 6,483,138		probably null	Het
Cd164	A	G	10: 41,523,181	T89A	probably benign	Het
Cep350	G	C	1: 155,933,104	N575K	possibly damaging	Het
Chrm5	A	G	2: 112,480,252	V173A	probably damaging	Het
Cnot1	A	G	8: 95,741,944	V1417A	possibly damaging	Het
Cntnap3	T	C	13: 64,758,390	T801A	probably damaging	Het
Cntnap5b	A	C	1: 100,072,140	K208Q	possibly damaging	Het
Crx	A	T	7: 15,869,347	V107D	possibly damaging	Het
Csrnp2	A	G	15: 100,489,440	F49S	probably damaging	Het
Ctbp1	A	G	5: 33,250,904	L228P	possibly damaging	Het
Ctdp1	A	T	18: 80,449,401	D626E	possibly damaging	Het
Cyp1a2	T	C	9: 57,682,286	T82A	possibly damaging	Het
Dnah3	T	A	7: 119,967,570	T2478S	possibly damaging	Het
Dnah3	T	G	7: 119,967,959	D2348A	probably damaging	Het
Dnah5	T	C	15: 28,343,591	I2379T	probably damaging	Het
Dnah6	A	G	6: 73,092,192	I2504T	probably damaging	Het
Dnase1l2	A	C	17: 24,441,651	W138G	probably damaging	Het
Dopey2	T	A	16: 93,766,173	I855N	probably damaging	Het
Dtx2	C	T	5: 136,032,293	R510*	probably null	Het
Fat4	G	T	3: 38,887,115	M52I	probably benign	Het
Fat4	G	A	3: 38,996,090	E4034K	probably damaging	Het
Fezf2	T	C	14: 12,344,350	K279R	probably damaging	Het
Fsip2	G	T	2: 82,976,517	W1060L	possibly damaging	Het
G6pc	T	A	11: 101,367,942	I49N	probably damaging	Het
Gars	A	G	6: 55,077,772	E688G	probably null	Het
Gdf11	T	C	10: 128,885,242	N361S	probably benign	Het
Gli3	A	C	13: 15,726,380	M1451L	probably benign	Het
Heatr3	T	C	8: 88,150,317	I329T	probably benign	Het
Herc3	T	G	6: 58,884,975		probably null	Het
Hrnr	A	G	3: 93,332,604	N3383S	unknown	Het
Igsf3	A	T	3: 101,431,296	I309F	probably benign	Het
Kif21b	C	T	1: 136,152,264	R513W	probably damaging	Het
Kif7	G	T	7: 79,699,241	H1195Q	probably benign	Het
Lpcat4	T	C	2: 112,242,542	V182A	possibly damaging	Het
Map3k21	T	A	8: 125,927,555	I371N	probably benign	Het
Mns1	G	A	9: 72,448,759		probably null	Het
Myo3a	A	G	2: 22,578,128	T465A	possibly damaging	Het
Nlrc4	A	T	17: 74,426,943	S992T	probably benign	Het
Notch4	G	A	17: 34,587,588	G1833E	possibly damaging	Het
Olfr160	A	T	9: 37,711,697	I194K	possibly damaging	Het
Olfr467	A	T	7: 107,814,700	I39L	probably benign	Het
Olfr600	T	A	7: 103,346,109	Y273F	possibly damaging	Het
Olfr666	T	C	7: 104,892,903	T242A	probably damaging	Het
Olfr998	G	A	2: 85,590,641	V34I	probably benign	Het
Pcdh9	G	A	14: 93,888,305	P143L	probably damaging	Het
Pik3cd	T	A	4: 149,663,203	T28S	probably damaging	Het
Pkd1	G	T	17: 24,576,592		probably null	Het
Plk4	A	T	3: 40,805,817	S383C	possibly damaging	Het
Plxna2	T	C	1: 194,643,989	L77P	probably damaging	Het
Ppm1f	T	C	16: 16,923,666	S335P	probably damaging	Het
Prr16	C	T	18: 51,303,277	P276L	probably damaging	Het
Rilp	A	G	11: 75,510,933		probably null	Het
Rspry1	A	G	8: 94,632,054		probably null	Het
Serpinb9b	T	C	13: 33,029,559	V33A	probably benign	Het
Slc4a10	C	A	2: 62,268,204	Q561K	probably damaging	Het
Smyd5	T	C	6: 85,438,136	I42T	possibly damaging	Het
Stk17b	T	C	1: 53,761,082	N246D	probably damaging	Het
Suco	T	C	1: 161,818,811		probably null	Het
Tcrg-C3	C	A	13: 19,260,994	F37L	probably damaging	Het
Tecpr1	C	T	5: 144,204,697	V785M	possibly damaging	Het
Telo2	C	T	17: 25,101,668	V756I	probably benign	Het
Tgm1	C	T	14: 55,705,577	R602H	probably benign	Het
Timeless	A	G	10: 128,244,187	T402A	probably damaging	Het
Tnfaip2	T	A	12: 111,449,891		probably null	Het
Trim5	A	G	7: 104,265,621	S414P	probably damaging	Het
Txnip	A	G	3: 96,559,750	T247A	possibly damaging	Het
Vmn1r174	A	T	7: 23,754,625	T239S	probably damaging	Het
Vmn1r231	T	A	17: 20,889,950	E234D	probably damaging	Het
Zranb3	A	T	1: 127,959,743	N982K	probably benign	Het

Other mutations in Dsc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Dsc3	APN	18	19985631	missense	probably null	1.00
IGL01978:Dsc3	APN	18	19974196	missense	possibly damaging	0.79
IGL02101:Dsc3	APN	18	20001906	missense	probably benign	0.01
IGL02165:Dsc3	APN	18	19983652	missense	probably benign	0.06
IGL02543:Dsc3	APN	18	19965828	missense	probably benign	0.11
IGL02970:Dsc3	APN	18	19968260	missense	probably damaging	1.00
IGL03097:Dsc3	UTSW	18	19974048	missense	probably benign	0.30
R0133:Dsc3	UTSW	18	19971582	missense	probably damaging	0.96
R0304:Dsc3	UTSW	18	19981241	missense	probably damaging	1.00
R0360:Dsc3	UTSW	18	19971582	missense	possibly damaging	0.79
R0673:Dsc3	UTSW	18	19989590	missense	probably damaging	1.00
R0826:Dsc3	UTSW	18	19981172	missense	probably damaging	0.99
R1120:Dsc3	UTSW	18	19986977	missense	probably benign	0.05
R1491:Dsc3	UTSW	18	19987034	missense	probably damaging	0.99
R1667:Dsc3	UTSW	18	19991560	missense	possibly damaging	0.58
R1688:Dsc3	UTSW	18	19966227	missense	probably damaging	1.00
R1792:Dsc3	UTSW	18	19986998	missense	probably damaging	1.00
R1858:Dsc3	UTSW	18	19965716	missense	probably damaging	0.97
R1965:Dsc3	UTSW	18	19980672	missense	probably damaging	1.00
R2049:Dsc3	UTSW	18	19989680	missense	possibly damaging	0.65
R2127:Dsc3	UTSW	18	19968354	missense	probably benign	0.00
R2143:Dsc3	UTSW	18	19980686	missense	possibly damaging	0.81
R2144:Dsc3	UTSW	18	19980686	missense	possibly damaging	0.81
R2148:Dsc3	UTSW	18	19965638	missense	probably damaging	0.99
R3038:Dsc3	UTSW	18	19991560	missense	possibly damaging	0.58
R3872:Dsc3	UTSW	18	19971508	missense	probably damaging	0.99
R4229:Dsc3	UTSW	18	19965821	missense	probably damaging	1.00
R4298:Dsc3	UTSW	18	19980754	missense	possibly damaging	0.62
R4491:Dsc3	UTSW	18	20001865	missense	probably benign	0.30
R4590:Dsc3	UTSW	18	19989695	missense	probably damaging	1.00
R4615:Dsc3	UTSW	18	19971488	missense	possibly damaging	0.67
R5316:Dsc3	UTSW	18	19963541	missense	possibly damaging	0.67
R5758:Dsc3	UTSW	18	19989534	missense	probably damaging	1.00
R5796:Dsc3	UTSW	18	19971501	missense	probably benign	0.01
R5916:Dsc3	UTSW	18	19987020	missense	probably damaging	1.00
R6022:Dsc3	UTSW	18	19966338	missense	probably damaging	0.97
R6233:Dsc3	UTSW	18	19965795	missense	possibly damaging	0.77
R6351:Dsc3	UTSW	18	19966291	missense	probably benign	0.05
R6971:Dsc3	UTSW	18	19966218	critical splice donor site	probably null
R7261:Dsc3	UTSW	18	19980757	nonsense	probably null
R7442:Dsc3	UTSW	18	19981156	missense	probably damaging	1.00
R7795:Dsc3	UTSW	18	19966231	missense	probably damaging	1.00
R8051:Dsc3	UTSW	18	19981213	missense	probably damaging	1.00
R8531:Dsc3	UTSW	18	19968392	missense	probably benign
R8531:Dsc3	UTSW	18	19981217	missense	probably damaging	1.00
R8872:Dsc3	UTSW	18	19989622	missense	probably benign	0.02
R8927:Dsc3	UTSW	18	19974177	missense	probably benign
R8928:Dsc3	UTSW	18	19974177	missense	probably benign
R9140:Dsc3	UTSW	18	19989559	missense	probably benign	0.01
R9493:Dsc3	UTSW	18	19989695	nonsense	probably null
X0061:Dsc3	UTSW	18	19989627	missense	probably damaging	1.00
Z1177:Dsc3	UTSW	18	19966315	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTATCTGCAGTTGTCAGTATCCATG -3'
(R):5'- GTGGCACTTACTGAGCTTCG -3'

Sequencing Primer
(F):5'- GCAGTTGTCAGTATCCATGTGTCC -3'
(R):5'- GTGGCACTTACTGAGCTTCGTAAAAC -3'

Posted On

2014-08-25