Incidental Mutation 'R1989:Cacna1b'
ID222948
Institutional Source Beutler Lab
Gene Symbol Cacna1b
Ensembl Gene ENSMUSG00000004113
Gene Namecalcium channel, voltage-dependent, N type, alpha 1B subunit
Synonymsalpha(1B), Cav2.2, Cchn1a
MMRRC Submission 040001-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1989 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location24603887-24763152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24721374 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 335 (Y335C)
Ref Sequence ENSEMBL: ENSMUSP00000110090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041342] [ENSMUST00000070864] [ENSMUST00000100348] [ENSMUST00000102939] [ENSMUST00000114447]
Predicted Effect probably damaging
Transcript: ENSMUST00000041342
AA Change: Y335C

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037416
Gene: ENSMUSG00000004113
AA Change: Y335C

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.2e-57 PFAM
PDB:4DEX|B 358 467 8e-66 PDB
Pfam:Ion_trans 516 708 1.1e-47 PFAM
Pfam:PKD_channel 569 715 2.3e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 916 933 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:Ion_trans 1174 1408 2.7e-52 PFAM
Pfam:Ion_trans 1498 1698 1.2e-59 PFAM
Pfam:PKD_channel 1551 1705 8.1e-9 PFAM
Ca_chan_IQ 1837 1871 1.09e-11 SMART
low complexity region 2040 2050 N/A INTRINSIC
low complexity region 2092 2114 N/A INTRINSIC
low complexity region 2276 2292 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070864
AA Change: Y335C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063236
Gene: ENSMUSG00000004113
AA Change: Y335C

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 467 8e-66 PDB
Pfam:Ion_trans 516 708 1.2e-47 PFAM
Pfam:PKD_channel 569 715 1.5e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 848 857 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 915 932 N/A INTRINSIC
low complexity region 1090 1101 N/A INTRINSIC
Pfam:Ion_trans 1173 1403 1.8e-52 PFAM
Pfam:Ion_trans 1493 1695 5.4e-60 PFAM
Pfam:PKD_channel 1544 1702 4.9e-9 PFAM
Ca_chan_IQ 1798 1832 7.2e-12 SMART
low complexity region 2001 2011 N/A INTRINSIC
low complexity region 2053 2075 N/A INTRINSIC
low complexity region 2237 2253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100348
AA Change: Y335C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097920
Gene: ENSMUSG00000004113
AA Change: Y335C

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 468 5e-68 PDB
Pfam:Ion_trans 517 709 1.2e-47 PFAM
Pfam:PKD_channel 570 716 1.6e-7 PFAM
low complexity region 729 740 N/A INTRINSIC
low complexity region 850 859 N/A INTRINSIC
low complexity region 904 914 N/A INTRINSIC
low complexity region 917 934 N/A INTRINSIC
low complexity region 1092 1103 N/A INTRINSIC
Pfam:Ion_trans 1175 1409 3.2e-52 PFAM
Pfam:Ion_trans 1499 1699 1.4e-59 PFAM
Pfam:PKD_channel 1552 1706 5.6e-9 PFAM
Ca_chan_IQ 1838 1872 1.09e-11 SMART
low complexity region 2041 2051 N/A INTRINSIC
low complexity region 2093 2115 N/A INTRINSIC
low complexity region 2277 2293 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102939
AA Change: Y335C

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100003
Gene: ENSMUSG00000004113
AA Change: Y335C

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 133 355 1.4e-57 PFAM
PDB:4DEX|B 358 467 1e-65 PDB
Pfam:Ion_trans 516 708 1.2e-47 PFAM
Pfam:PKD_channel 569 715 1.6e-7 PFAM
low complexity region 728 739 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 916 933 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:Ion_trans 1174 1404 1.9e-52 PFAM
Pfam:Ion_trans 1494 1696 5.5e-60 PFAM
Pfam:PKD_channel 1545 1703 5e-9 PFAM
Ca_chan_IQ 1835 1869 1.09e-11 SMART
low complexity region 2038 2048 N/A INTRINSIC
low complexity region 2090 2112 N/A INTRINSIC
low complexity region 2274 2290 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114447
AA Change: Y335C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110090
Gene: ENSMUSG00000004113
AA Change: Y335C

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Ion_trans 94 367 8.5e-69 PFAM
Pfam:Ion_trans 482 721 2.4e-57 PFAM
Pfam:PKD_channel 571 715 1e-7 PFAM
low complexity region 729 740 N/A INTRINSIC
low complexity region 850 859 N/A INTRINSIC
low complexity region 904 914 N/A INTRINSIC
low complexity region 917 934 N/A INTRINSIC
low complexity region 1092 1103 N/A INTRINSIC
Pfam:Ion_trans 1139 1421 1.3e-62 PFAM
Pfam:Ion_trans 1464 1711 3.2e-64 PFAM
Pfam:PKD_channel 1550 1706 2.7e-9 PFAM
Pfam:GPHH 1713 1783 1.9e-39 PFAM
Ca_chan_IQ 1838 1872 1.09e-11 SMART
low complexity region 2041 2051 N/A INTRINSIC
low complexity region 2093 2115 N/A INTRINSIC
low complexity region 2277 2293 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the pore-forming subunit of an N-type voltage-dependent calcium channel, which controls neurotransmitter release from neurons. The encoded protein forms a complex with alpha-2, beta, and delta subunits to form the high-voltage activated channel. This channel is sensitive to omega-conotoxin-GVIA and omega-agatoxin-IIIA but insensitive to dihydropyridines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice deficient in this gene exhibit defects in nociception, memory and learning. They also exhibit hyperactive and hyperaggressive behaviors as well as defects in the the sleep-wake cycle. Deficits in the sympathetic nervous system results in defects in circulatory regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,896 D216V possibly damaging Het
Acaca T C 11: 84,262,529 M921T probably damaging Het
Actn2 A T 13: 12,340,395 W36R probably benign Het
Adcy9 A T 16: 4,298,727 V643D probably damaging Het
Agbl4 A T 4: 111,566,682 T302S possibly damaging Het
Akap13 A G 7: 75,704,516 N1795S probably benign Het
Ang T A 14: 51,101,551 C50S probably damaging Het
Anxa13 T A 15: 58,341,948 noncoding transcript Het
Asxl3 T C 18: 22,452,363 V115A probably damaging Het
B4galt5 A T 2: 167,305,003 W304R probably damaging Het
Bptf T C 11: 107,074,826 K1118E probably damaging Het
Catsperb A T 12: 101,602,711 I881F probably damaging Het
Chrm5 A G 2: 112,480,252 V173A probably damaging Het
Cyfip2 A T 11: 46,253,998 Y676* probably null Het
Cyp2f2 A G 7: 27,129,203 D90G probably damaging Het
Cyr61 A T 3: 145,647,743 Y355N probably benign Het
Dnah5 T C 15: 28,343,591 I2379T probably damaging Het
E2f8 T C 7: 48,873,280 E349G probably benign Het
Ebf1 T C 11: 44,621,966 M134T probably damaging Het
Fn1 T C 1: 71,651,625 H59R probably damaging Het
Focad T C 4: 88,232,784 probably null Het
Gabra1 A T 11: 42,155,015 D89E probably damaging Het
Hip1r G T 5: 123,989,698 V90F probably damaging Het
Ifi213 C A 1: 173,568,808 probably null Het
Kcnj9 A G 1: 172,326,149 I136T probably benign Het
Kmt2c A G 5: 25,498,544 S3P possibly damaging Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Lrrk1 G A 7: 66,281,684 S43L probably damaging Het
Macf1 A G 4: 123,497,726 probably null Het
Mad1l1 A G 5: 140,303,670 S167P probably benign Het
Maml3 G T 3: 51,697,758 A64D probably damaging Het
Mgat4c T C 10: 102,378,159 M1T probably null Het
Mkrn2os G T 6: 115,589,350 T88K probably damaging Het
Mob3c T C 4: 115,831,557 Y96H probably damaging Het
Mpo T A 11: 87,803,472 I96N probably damaging Het
Mup17 T A 4: 61,593,623 Y138F probably benign Het
Myh8 A G 11: 67,292,724 I754V probably benign Het
Naa30 T A 14: 49,178,140 L289* probably null Het
Nap1l4 A C 7: 143,527,184 F292V probably damaging Het
Nek5 T A 8: 22,111,169 N129Y probably damaging Het
Nlrp9a A G 7: 26,573,913 E880G probably benign Het
Nsun6 G T 2: 15,038,184 N155K probably benign Het
Olfr1189 T A 2: 88,592,599 I265K probably damaging Het
Olfr1318 T A 2: 112,156,377 I142N probably benign Het
Olfr170 A T 16: 19,606,657 Y4N probably benign Het
Olfr467 A T 7: 107,814,700 I39L probably benign Het
Olfr600 T A 7: 103,346,109 Y273F possibly damaging Het
Olfr622 A T 7: 103,639,495 I215K probably damaging Het
Olfr930 T C 9: 38,930,875 S235P possibly damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Ppp2r5d C T 17: 46,684,099 V559M probably benign Het
Ptgfr A T 3: 151,835,339 Y177* probably null Het
Rnase10 A T 14: 51,009,638 I121L probably benign Het
Sall2 G A 14: 52,314,439 P431L probably damaging Het
Sbf2 A G 7: 110,348,923 V1194A possibly damaging Het
Scimp T C 11: 70,791,576 K105E possibly damaging Het
Scrt2 A T 2: 152,082,087 D13V probably damaging Het
Snx19 A G 9: 30,428,108 S181G possibly damaging Het
Spata2 G A 2: 167,484,314 T195M possibly damaging Het
Sptbn4 A G 7: 27,367,702 V614A probably damaging Het
Srpk2 G A 5: 23,518,423 A565V probably damaging Het
Stard9 A G 2: 120,701,406 I2715V probably benign Het
Sval1 A G 6: 41,955,491 T92A possibly damaging Het
Synrg T C 11: 84,019,955 probably null Het
Tlr12 T C 4: 128,617,069 T463A probably benign Het
Tnxb A G 17: 34,683,377 H945R probably benign Het
Tnxb A T 17: 34,693,885 D1791V probably damaging Het
Topaz1 C T 9: 122,750,125 T700I possibly damaging Het
Trappc8 A G 18: 20,845,651 V796A probably benign Het
Trpm1 A T 7: 64,209,032 probably null Het
Ttll4 G T 1: 74,685,368 V566L possibly damaging Het
Ttn T A 2: 76,750,941 N23203Y probably damaging Het
Ttn A T 2: 76,770,787 Y18781N probably damaging Het
Tuba3a T C 6: 125,281,253 N258S probably damaging Het
Upk1b A T 16: 38,784,241 W141R possibly damaging Het
Vars T C 17: 35,011,838 F567L possibly damaging Het
Vcpip1 G C 1: 9,745,563 A865G probably benign Het
Vmn2r22 A T 6: 123,637,541 F363L probably damaging Het
Vmn2r66 A T 7: 85,011,993 F10I probably benign Het
Wbp2 C T 11: 116,080,221 probably null Het
Yy1 T C 12: 108,806,608 L270P probably damaging Het
Zan A T 5: 137,420,006 C2943* probably null Het
Zfp51 T A 17: 21,456,320 Y18N possibly damaging Het
Other mutations in Cacna1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cacna1b APN 2 24651200 nonsense probably null
IGL00508:Cacna1b APN 2 24657289 critical splice donor site probably null
IGL01085:Cacna1b APN 2 24678994 missense probably damaging 0.98
IGL01310:Cacna1b APN 2 24685782 missense probably damaging 1.00
IGL01361:Cacna1b APN 2 24679095 missense possibly damaging 0.49
IGL01471:Cacna1b APN 2 24657292 missense probably damaging 1.00
IGL01537:Cacna1b APN 2 24658528 missense probably damaging 1.00
IGL01547:Cacna1b APN 2 24632035 unclassified probably benign
IGL01750:Cacna1b APN 2 24654395 missense probably damaging 1.00
IGL01813:Cacna1b APN 2 24609890 missense probably damaging 1.00
IGL01939:Cacna1b APN 2 24661757 missense probably damaging 1.00
IGL01955:Cacna1b APN 2 24639137 missense probably damaging 1.00
IGL01972:Cacna1b APN 2 24635095 critical splice donor site probably null
IGL01987:Cacna1b APN 2 24697567 splice site probably null
IGL02096:Cacna1b APN 2 24678915 missense probably benign 0.01
IGL02111:Cacna1b APN 2 24606991 missense probably damaging 0.96
IGL02254:Cacna1b APN 2 24616815 splice site probably null
IGL03084:Cacna1b APN 2 24609932 missense probably benign
IGL03184:Cacna1b APN 2 24658489 critical splice donor site probably null
IGL03202:Cacna1b APN 2 24651112 missense probably damaging 1.00
IGL03210:Cacna1b APN 2 24650572 missense probably benign 0.00
IGL03402:Cacna1b APN 2 24762809 missense probably damaging 1.00
PIT4283001:Cacna1b UTSW 2 24631941 missense probably damaging 1.00
R0062:Cacna1b UTSW 2 24758331 missense probably damaging 1.00
R0062:Cacna1b UTSW 2 24758331 missense probably damaging 1.00
R0206:Cacna1b UTSW 2 24607480 missense probably damaging 1.00
R0208:Cacna1b UTSW 2 24607480 missense probably damaging 1.00
R0240:Cacna1b UTSW 2 24638657 unclassified probably benign
R0265:Cacna1b UTSW 2 24761844 missense probably damaging 1.00
R0352:Cacna1b UTSW 2 24625232 intron probably benign
R0376:Cacna1b UTSW 2 24659003 splice site probably benign
R0383:Cacna1b UTSW 2 24761844 missense probably damaging 1.00
R0432:Cacna1b UTSW 2 24687704 missense probably damaging 1.00
R0595:Cacna1b UTSW 2 24649989 splice site probably benign
R0660:Cacna1b UTSW 2 24654446 missense probably damaging 1.00
R0664:Cacna1b UTSW 2 24654446 missense probably damaging 1.00
R1107:Cacna1b UTSW 2 24697603 missense probably damaging 1.00
R1184:Cacna1b UTSW 2 24687745 unclassified probably null
R1445:Cacna1b UTSW 2 24718136 splice site probably benign
R1446:Cacna1b UTSW 2 24706177 missense probably benign 0.01
R1496:Cacna1b UTSW 2 24678035 missense probably benign
R1614:Cacna1b UTSW 2 24690807 missense possibly damaging 0.88
R1626:Cacna1b UTSW 2 24606709 missense probably damaging 1.00
R1917:Cacna1b UTSW 2 24616879 missense probably null 0.80
R1984:Cacna1b UTSW 2 24648986 missense probably damaging 1.00
R1986:Cacna1b UTSW 2 24648986 missense probably damaging 1.00
R1990:Cacna1b UTSW 2 24732306 missense probably damaging 1.00
R1991:Cacna1b UTSW 2 24732306 missense probably damaging 1.00
R1992:Cacna1b UTSW 2 24732306 missense probably damaging 1.00
R2098:Cacna1b UTSW 2 24650546 missense probably damaging 1.00
R2139:Cacna1b UTSW 2 24679473 missense probably benign 0.07
R2196:Cacna1b UTSW 2 24761788 missense probably damaging 1.00
R2229:Cacna1b UTSW 2 24685804 missense probably damaging 1.00
R2292:Cacna1b UTSW 2 24606620 missense probably benign 0.01
R2570:Cacna1b UTSW 2 24606637 nonsense probably null
R2850:Cacna1b UTSW 2 24761788 missense probably damaging 1.00
R2911:Cacna1b UTSW 2 24607541 unclassified probably null
R2937:Cacna1b UTSW 2 24606528 missense probably benign 0.00
R2938:Cacna1b UTSW 2 24606528 missense probably benign 0.00
R3522:Cacna1b UTSW 2 24763043 missense possibly damaging 0.94
R3800:Cacna1b UTSW 2 24658959 missense probably benign 0.15
R4166:Cacna1b UTSW 2 24677911 missense probably benign 0.32
R4300:Cacna1b UTSW 2 24635239 missense probably damaging 1.00
R4366:Cacna1b UTSW 2 24702620 missense probably damaging 1.00
R4493:Cacna1b UTSW 2 24652938 missense probably damaging 0.99
R4494:Cacna1b UTSW 2 24652938 missense probably damaging 0.99
R4522:Cacna1b UTSW 2 24654430 missense probably damaging 1.00
R4612:Cacna1b UTSW 2 24626852 nonsense probably null
R4673:Cacna1b UTSW 2 24631944 missense probably damaging 1.00
R4703:Cacna1b UTSW 2 24654463 missense probably damaging 1.00
R4704:Cacna1b UTSW 2 24654463 missense probably damaging 1.00
R4777:Cacna1b UTSW 2 24732325 missense probably damaging 1.00
R4795:Cacna1b UTSW 2 24637487 missense possibly damaging 0.58
R4796:Cacna1b UTSW 2 24637487 missense possibly damaging 0.58
R4962:Cacna1b UTSW 2 24618318 missense probably damaging 1.00
R4962:Cacna1b UTSW 2 24657366 missense probably damaging 1.00
R4974:Cacna1b UTSW 2 24648523 missense probably damaging 0.99
R4990:Cacna1b UTSW 2 24678874 critical splice donor site probably null
R5109:Cacna1b UTSW 2 24690785 missense possibly damaging 0.88
R5117:Cacna1b UTSW 2 24732328 missense probably damaging 1.00
R5176:Cacna1b UTSW 2 24635131 missense probably damaging 1.00
R5253:Cacna1b UTSW 2 24719952 missense probably damaging 1.00
R5372:Cacna1b UTSW 2 24733959 missense probably damaging 1.00
R5374:Cacna1b UTSW 2 24706216 missense probably damaging 1.00
R5465:Cacna1b UTSW 2 24650426 critical splice donor site probably null
R5568:Cacna1b UTSW 2 24607600 missense probably damaging 1.00
R5580:Cacna1b UTSW 2 24650554 missense probably damaging 1.00
R5677:Cacna1b UTSW 2 24679358 missense possibly damaging 0.64
R6277:Cacna1b UTSW 2 24730796 missense probably damaging 1.00
R6294:Cacna1b UTSW 2 24719057 missense possibly damaging 0.94
R6609:Cacna1b UTSW 2 24653049 missense probably damaging 1.00
R6929:Cacna1b UTSW 2 24632010 missense probably damaging 1.00
R7016:Cacna1b UTSW 2 24762848 missense possibly damaging 0.77
R7112:Cacna1b UTSW 2 24690761 missense probably damaging 0.97
R7162:Cacna1b UTSW 2 24700022 missense probably benign 0.06
R7401:Cacna1b UTSW 2 24679294 missense probably benign 0.00
R7402:Cacna1b UTSW 2 24607659 missense probably benign 0.21
R7442:Cacna1b UTSW 2 24607501 missense probably benign
R7450:Cacna1b UTSW 2 24635135 nonsense probably null
R7481:Cacna1b UTSW 2 24616862 missense probably damaging 0.99
R7792:Cacna1b UTSW 2 24677965 missense probably damaging 0.99
Z1088:Cacna1b UTSW 2 24661844 missense probably damaging 1.00
Z1088:Cacna1b UTSW 2 24733945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTCTCAGGTAGGGGCACAG -3'
(R):5'- TACACCCTGGGAAGGTTCTG -3'

Sequencing Primer
(F):5'- GACATAACTTCCTCACTGGTAGTGG -3'
(R):5'- TCTGTGAGTCAAAAATGGGTCTGAC -3'
Posted On2014-08-25