Incidental Mutation 'R0141:Lhx9'
ID 22295
Institutional Source Beutler Lab
Gene Symbol Lhx9
Ensembl Gene ENSMUSG00000019230
Gene Name LIM homeobox protein 9
Synonyms 3110009O07Rik, Lhx9 alpha, LH2B
MMRRC Submission 038426-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.828) question?
Stock # R0141 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 1
Chromosomal Location 138825186-138848577 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 138840006 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 73 (Y73H)
Ref Sequence ENSEMBL: ENSMUSP00000036480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019374] [ENSMUST00000046870] [ENSMUST00000093486] [ENSMUST00000112026] [ENSMUST00000112030] [ENSMUST00000194557]
AlphaFold Q9WUH2
Predicted Effect probably benign
Transcript: ENSMUST00000019374
AA Change: Y82H

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000019374
Gene: ENSMUSG00000019230
AA Change: Y82H

DomainStartEndE-ValueType
LIM 70 123 4.48e-17 SMART
LIM 132 186 8.04e-19 SMART
HOX 267 319 1.89e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000046870
AA Change: Y73H

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036480
Gene: ENSMUSG00000019230
AA Change: Y73H

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 320 8.07e-22 SMART
low complexity region 344 368 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000093486
AA Change: Y73H

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091198
Gene: ENSMUSG00000019230
AA Change: Y73H

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 310 1.89e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112026
AA Change: Y82H

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107657
Gene: ENSMUSG00000019230
AA Change: Y82H

DomainStartEndE-ValueType
LIM 70 123 4.48e-17 SMART
LIM 132 186 8.04e-19 SMART
HOX 267 329 8.07e-22 SMART
low complexity region 353 377 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112030
AA Change: Y73H

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107661
Gene: ENSMUSG00000019230
AA Change: Y73H

DomainStartEndE-ValueType
LIM 61 114 4.48e-17 SMART
LIM 123 177 8.04e-19 SMART
HOX 258 310 1.89e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194557
Meta Mutation Damage Score 0.6153 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency 88% (50/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LIM homeobox gene family of developmentally expressed transcription factors. The encoded protein contains a homeodomain and two cysteine-rich zinc-binding LIM domains involved in protein-protein interactions. The protein is highly similar to a mouse protein that causes gonadal agenesis when inactivated, suggesting a role in gonadal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit failed proliferation of the somatic cells of the genital ridge resulting in lack of discrete gonad formation, infertility in both sexes, and female-like genitalia in genetically male mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,683,782 N772K probably benign Het
Acot12 A C 13: 91,771,828 D294A probably benign Het
Adamts9 T C 6: 92,943,085 D24G probably benign Het
Ahnak G A 19: 9,006,680 G1776D probably damaging Het
Arfgef3 C A 10: 18,597,407 C1636F probably damaging Het
AW551984 A G 9: 39,590,644 L722P probably damaging Het
Ccndbp1 T A 2: 121,012,422 M188K probably damaging Het
Col27a1 A T 4: 63,265,633 probably null Het
Cpt1c A G 7: 44,966,671 Y306H probably damaging Het
Cyp3a57 A G 5: 145,362,102 I71V probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dmrt2 A T 19: 25,678,291 Q418L possibly damaging Het
Ebf1 T C 11: 44,908,000 L284S probably damaging Het
Fam131a G A 16: 20,698,988 A15T probably benign Het
Fbxo17 A G 7: 28,733,491 T146A possibly damaging Het
Fer1l6 A G 15: 58,558,402 E226G probably damaging Het
Galnt18 A T 7: 111,599,031 I174N probably damaging Het
Gm13088 T C 4: 143,654,568 Y295C probably benign Het
Gm44501 T C 17: 40,578,853 I86T probably benign Het
Gm884 A C 11: 103,613,686 I2485M probably damaging Het
Gtsf1l T C 2: 163,087,326 Q79R probably benign Het
Hapln4 T C 8: 70,088,280 L321P probably damaging Het
Herc2 A G 7: 56,121,561 T1024A probably benign Het
Hps5 A G 7: 46,789,181 S43P probably damaging Het
Igsf10 A G 3: 59,330,832 Y643H probably damaging Het
Lama4 G A 10: 39,092,278 R1472H probably benign Het
Loxl1 T A 9: 58,312,132 Q252L probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nr3c2 T A 8: 76,908,408 V46D probably damaging Het
Olfr1283 T A 2: 111,369,490 I286N probably damaging Het
Olfr152 C G 2: 87,782,705 P55R possibly damaging Het
Olfr487 A C 7: 108,212,003 N175K possibly damaging Het
Olfr495 A T 7: 108,395,368 N83Y probably benign Het
Olfr749 T C 14: 50,736,383 S260G possibly damaging Het
Osbp T C 19: 11,973,859 V256A possibly damaging Het
Pclo A T 5: 14,791,922 D4737V unknown Het
Pkdrej A G 15: 85,815,630 I2035T probably damaging Het
Plek2 A G 12: 78,894,504 S185P probably damaging Het
Pnpla6 G T 8: 3,532,117 probably null Het
Pou3f2 T C 4: 22,487,210 T308A possibly damaging Het
Pxmp4 A G 2: 154,592,295 V82A probably damaging Het
Rnf6 A T 5: 146,211,835 N135K possibly damaging Het
Rtl1 A G 12: 109,592,948 V819A probably damaging Het
Scn1a C A 2: 66,289,062 V1355L probably damaging Het
Scn2a T A 2: 65,711,816 N754K probably benign Het
Serpina3b A T 12: 104,130,771 N104Y probably damaging Het
Sh3rf2 T C 18: 42,156,057 S648P probably benign Het
Slc17a6 G A 7: 51,669,067 V486I probably benign Het
Syne2 T G 12: 75,941,298 D1743E probably damaging Het
Tex14 T G 11: 87,493,031 probably null Het
Tfb1m T C 17: 3,554,957 D87G probably damaging Het
Tll2 C T 19: 41,097,912 G609S probably damaging Het
Tsc22d2 A T 3: 58,417,156 probably benign Het
Tsen2 A G 6: 115,568,829 D360G probably damaging Het
Ugt2b37 G A 5: 87,240,983 P457L probably damaging Het
Vmn1r68 T C 7: 10,527,325 N282S possibly damaging Het
Vmn2r58 G A 7: 41,861,885 S498F probably benign Het
Zfp959 T C 17: 55,898,139 I392T probably benign Het
Other mutations in Lhx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Lhx9 APN 1 138828680 missense possibly damaging 0.74
IGL01624:Lhx9 APN 1 138832783 nonsense probably null
IGL02149:Lhx9 APN 1 138831434 missense probably damaging 1.00
IGL02452:Lhx9 APN 1 138841842 missense probably damaging 1.00
IGL02982:Lhx9 APN 1 138838611 missense probably damaging 1.00
R0123:Lhx9 UTSW 1 138838679 missense probably damaging 1.00
R0134:Lhx9 UTSW 1 138838679 missense probably damaging 1.00
R0225:Lhx9 UTSW 1 138838679 missense probably damaging 1.00
R0281:Lhx9 UTSW 1 138832904 missense probably benign 0.00
R1460:Lhx9 UTSW 1 138838709 splice site probably benign
R1932:Lhx9 UTSW 1 138842009 start gained probably benign
R4738:Lhx9 UTSW 1 138832748 missense probably damaging 1.00
R4792:Lhx9 UTSW 1 138838351 missense possibly damaging 0.87
R4820:Lhx9 UTSW 1 138838367 missense probably benign 0.00
R4877:Lhx9 UTSW 1 138838354 missense probably benign 0.04
R6035:Lhx9 UTSW 1 138838543 missense possibly damaging 0.67
R6035:Lhx9 UTSW 1 138838543 missense possibly damaging 0.67
R6825:Lhx9 UTSW 1 138841806 frame shift probably null
R6852:Lhx9 UTSW 1 138841806 frame shift probably null
R6853:Lhx9 UTSW 1 138841806 frame shift probably null
R7264:Lhx9 UTSW 1 138832751 missense probably damaging 0.98
R8097:Lhx9 UTSW 1 138838351 missense probably damaging 0.97
R8164:Lhx9 UTSW 1 138832780 missense probably damaging 1.00
R8245:Lhx9 UTSW 1 138838441 missense probably benign 0.24
R8278:Lhx9 UTSW 1 138838586 missense probably damaging 0.98
R8951:Lhx9 UTSW 1 138841966 missense probably damaging 1.00
Z1177:Lhx9 UTSW 1 138831498 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTCTCGCAGTGGCTCTATCGCAG -3'
(R):5'- GTAGGCTCTCAGCAAGCTCAAGATG -3'

Sequencing Primer
(F):5'- GGCTCTATCGCAGTGGTTCTATC -3'
(R):5'- GCAAATGTTTCTGTGGCCC -3'
Posted On 2013-04-16