Mutagenetix > Incidental Mutation

Incidental Mutation 'R2016:Plcb1'

222964

Institutional Source

Beutler Lab

Gene Symbol

Plcb1

Ensembl Gene

ENSMUSG00000051177

Gene Name

phospholipase C, beta 1

Synonyms

3110043I21Rik

MMRRC Submission

040025-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.411) question?

Stock #

R2016 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

134786067-135475258 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 135362420 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 898 (I898N)

Ref Sequence

ENSEMBL: ENSMUSP00000118756 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]

AlphaFold

Q9Z1B3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070724
AA Change: I898N

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: I898N

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	2.2e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1.3e-7	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	997	1155	1.9e-64	PFAM
low complexity region	1157	1168	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110116
AA Change: I898N

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: I898N

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	4.1e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1.1e-9	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	1003	1176	2.9e-61	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131552
AA Change: I898N

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: I898N

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	3.9e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1e-9	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	1003	1148	8e-51	PFAM
low complexity region	1157	1168	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153402

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025C18Rik	T	C	2: 165,079,026	D29G	unknown	Het
Abca13	A	T	11: 9,290,619	L827F	probably damaging	Het
Abca8a	A	G	11: 110,070,387	F570L	probably damaging	Het
Adck1	T	A	12: 88,461,092	I493N	probably damaging	Het
Adra2c	T	C	5: 35,280,312	C143R	probably damaging	Het
Akap13	C	T	7: 75,704,531	T1800M	probably damaging	Het
Angpt2	T	C	8: 18,705,731	N240S	probably damaging	Het
Apob	G	A	12: 8,007,751	D2078N	possibly damaging	Het
Atp8b1	T	C	18: 64,540,334	N989S	probably damaging	Het
B3gnt2	T	C	11: 22,836,621	D189G	probably damaging	Het
Bcam	G	A	7: 19,760,349	T374M	probably benign	Het
Blm	T	C	7: 80,505,926	D335G	probably benign	Het
Cbfa2t2	T	C	2: 154,517,807	L264P	probably damaging	Het
Col4a2	T	C	8: 11,445,086	F1515L	probably benign	Het
Csf2ra	T	G	19: 61,226,893	M95L	probably benign	Het
Cyp2c70	T	A	19: 40,164,412	T300S	possibly damaging	Het
Cyp4f15	A	T	17: 32,702,159	H440L	probably damaging	Het
Dcaf1	T	A	9: 106,839,088	D360E	probably benign	Het
Ddr2	T	C	1: 169,984,968	M652V	probably damaging	Het
Dnah2	T	A	11: 69,437,070	I3370F	probably damaging	Het
Dpysl5	G	A	5: 30,791,597	D399N	probably damaging	Het
Efemp1	G	T	11: 28,921,613	R376L	probably damaging	Het
Efl1	A	C	7: 82,753,709	D673A	probably damaging	Het
Eid1	A	G	2: 125,673,201	M4V	probably benign	Het
Emc10	G	A	7: 44,493,192	R109W	probably damaging	Het
Emilin3	G	A	2: 160,909,610	R170C	possibly damaging	Het
Erap1	T	C	13: 74,664,151	W362R	probably damaging	Het
Fam208b	A	T	13: 3,576,770	I1060K	probably benign	Het
Fam234a	A	G	17: 26,218,316	F91L	probably benign	Het
Fam71e2	A	T	7: 4,759,398	I244N	probably damaging	Het
Flnc	G	A	6: 29,443,797		probably null	Het
Fsip2	A	G	2: 82,982,732	K3132E	possibly damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gnl3	A	G	14: 31,016,369		probably null	Het
Has1	A	T	17: 17,848,270	I274N	probably damaging	Het
Itsn1	T	C	16: 91,905,501		probably null	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Kif13a	T	C	13: 46,810,799	D475G	probably benign	Het
Klhl20	A	T	1: 161,103,038	M298K	probably damaging	Het
Kynu	G	T	2: 43,604,277	G241*	probably null	Het
Lrif1	G	T	3: 106,732,206	L202F	possibly damaging	Het
Lrp5	T	C	19: 3,610,056	K1003E	probably benign	Het
Mamdc2	T	C	19: 23,334,029	D487G	probably damaging	Het
Mapk8ip1	A	G	2: 92,391,034		probably null	Het
Mettl25	T	A	10: 105,797,306	E425D	probably benign	Het
Midn	G	T	10: 80,150,115	R13L	possibly damaging	Het
Mtmr9	T	C	14: 63,540,264	Y136C	possibly damaging	Het
Mylk	G	A	16: 34,996,817	V61M	probably damaging	Het
Nalcn	T	C	14: 123,594,581		probably null	Het
Nle1	G	T	11: 82,905,547	P166Q	probably damaging	Het
Nr4a3	G	A	4: 48,083,252	C595Y	probably damaging	Het
Olfr1133	C	T	2: 87,646,052	V24M	probably benign	Het
Olfr1288	G	T	2: 111,479,187	M134I	probably benign	Het
Olfr724	A	G	14: 49,960,502	I190T	probably benign	Het
Olfr906	A	T	9: 38,488,013		probably null	Het
Olfr963	A	G	9: 39,669,555	Y166C	probably damaging	Het
Pds5a	T	A	5: 65,648,007		probably null	Het
Pitpnm1	T	C	19: 4,111,873	V955A	probably benign	Het
Plcl2	G	A	17: 50,606,694	V244M	probably damaging	Het
Plk1	A	G	7: 122,162,440	K257R	probably damaging	Het
Prkcg	A	T	7: 3,323,550	T460S	probably damaging	Het
Prl7d1	G	A	13: 27,710,173	H138Y	probably damaging	Het
Prss35	A	G	9: 86,755,512	S112G	probably benign	Het
Ptprj	C	T	2: 90,464,614	V417M	probably damaging	Het
Pwwp2b	A	T	7: 139,256,151	I503F	possibly damaging	Het
Rasgrp2	T	C	19: 6,413,165	V498A	probably benign	Het
Sall1	A	G	8: 89,028,409	V1314A	probably benign	Het
Sema6c	A	G	3: 95,171,234	I549V	probably benign	Het
Slc17a1	A	G	13: 23,878,539	S230G	probably benign	Het
Slc5a4a	T	G	10: 76,153,580	F106V	probably benign	Het
Spata5	T	C	3: 37,578,762	V839A	possibly damaging	Het
Stat6	T	C	10: 127,650,796	L147P	probably damaging	Het
Taar7d	T	A	10: 24,027,744	S175T	probably benign	Het
Tmem132b	A	G	5: 125,623,016	Q206R	probably benign	Het
Tmem229a	T	C	6: 24,955,062	D231G	probably benign	Het
Trim66	A	G	7: 109,472,232		probably null	Het
Ttc30a1	A	G	2: 75,981,457	L94P	probably benign	Het
Ttll9	A	T	2: 153,002,294	E374V	probably damaging	Het
Vmn2r69	A	T	7: 85,407,285	D548E	probably damaging	Het
Zcchc2	T	A	1: 106,004,121		probably null	Het
Zfp282	T	A	6: 47,897,787		probably null	Het
Zfp352	A	G	4: 90,225,171	E516G	probably benign	Het

Other mutations in Plcb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00510:Plcb1	APN	2	135251756	missense	possibly damaging	0.66
IGL01152:Plcb1	APN	2	134813659	missense	probably damaging	1.00
IGL01945:Plcb1	APN	2	135220791	missense	probably benign	0.03
IGL01999:Plcb1	APN	2	135346318	missense	probably damaging	1.00
IGL02109:Plcb1	APN	2	134786559	missense	probably damaging	1.00
IGL02153:Plcb1	APN	2	135387853	missense	probably benign	0.08
IGL02207:Plcb1	APN	2	135387171	missense	probably damaging	1.00
IGL02566:Plcb1	APN	2	135472263	missense	probably benign	0.17
IGL02590:Plcb1	APN	2	135294864	missense	probably benign	0.08
IGL02640:Plcb1	APN	2	135220859	splice site	probably benign
IGL02926:Plcb1	APN	2	135364762	splice site	probably benign
IGL03071:Plcb1	APN	2	135387802	missense	probably damaging	1.00
IGL03236:Plcb1	APN	2	135346306	missense	probably damaging	1.00
IGL03252:Plcb1	APN	2	135370428	missense	probably benign
IGL03387:Plcb1	APN	2	134813686	splice site	probably benign
BB001:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
BB011:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
R0024:Plcb1	UTSW	2	135362425	missense	probably benign	0.06
R0024:Plcb1	UTSW	2	135362425	missense	probably benign	0.06
R0053:Plcb1	UTSW	2	135294915	missense	probably benign	0.33
R0053:Plcb1	UTSW	2	135294915	missense	probably benign	0.33
R0308:Plcb1	UTSW	2	134813614	missense	probably benign	0.01
R0415:Plcb1	UTSW	2	135337499	missense	probably damaging	1.00
R0624:Plcb1	UTSW	2	135294911	missense	possibly damaging	0.81
R0898:Plcb1	UTSW	2	135387143	missense	possibly damaging	0.73
R1071:Plcb1	UTSW	2	135325657	missense	possibly damaging	0.64
R1615:Plcb1	UTSW	2	135362444	splice site	probably benign
R1617:Plcb1	UTSW	2	135337441	missense	probably damaging	1.00
R1785:Plcb1	UTSW	2	135325667	nonsense	probably null
R1866:Plcb1	UTSW	2	135344173	missense	probably benign	0.01
R1869:Plcb1	UTSW	2	135311014	missense	probably benign	0.02
R1902:Plcb1	UTSW	2	134813613	missense	possibly damaging	0.93
R1938:Plcb1	UTSW	2	135386302	missense	probably damaging	1.00
R2017:Plcb1	UTSW	2	135362420	missense	possibly damaging	0.94
R2131:Plcb1	UTSW	2	135325667	nonsense	probably null
R2132:Plcb1	UTSW	2	135325667	nonsense	probably null
R2133:Plcb1	UTSW	2	135325667	nonsense	probably null
R2164:Plcb1	UTSW	2	135346330	missense	possibly damaging	0.87
R2419:Plcb1	UTSW	2	135262100	splice site	probably benign
R2429:Plcb1	UTSW	2	135337442	missense	probably damaging	0.99
R2508:Plcb1	UTSW	2	135260508	missense	probably benign	0.27
R3161:Plcb1	UTSW	2	135335482	missense	probably benign	0.03
R3870:Plcb1	UTSW	2	135325671	missense	probably damaging	0.99
R4191:Plcb1	UTSW	2	135345090	missense	probably damaging	1.00
R4239:Plcb1	UTSW	2	135344158	missense	probably damaging	0.99
R4552:Plcb1	UTSW	2	135335493	missense	probably benign	0.44
R4553:Plcb1	UTSW	2	135335493	missense	probably benign	0.44
R4720:Plcb1	UTSW	2	135251747	missense	possibly damaging	0.70
R4946:Plcb1	UTSW	2	135345095	missense	probably benign	0.01
R5012:Plcb1	UTSW	2	135333400	missense	probably null	0.97
R5151:Plcb1	UTSW	2	135262245	missense	probably benign	0.28
R5320:Plcb1	UTSW	2	135252776	missense	possibly damaging	0.56
R5415:Plcb1	UTSW	2	135347402	missense	possibly damaging	0.67
R5523:Plcb1	UTSW	2	135260566	missense	probably benign	0.08
R5568:Plcb1	UTSW	2	135370593	missense	probably damaging	1.00
R5688:Plcb1	UTSW	2	135335480	missense	probably benign	0.06
R5809:Plcb1	UTSW	2	135262244	missense	possibly damaging	0.83
R6237:Plcb1	UTSW	2	135370566	missense	possibly damaging	0.94
R6315:Plcb1	UTSW	2	135346341	missense	probably benign	0.00
R6478:Plcb1	UTSW	2	135335451	missense	probably damaging	1.00
R6531:Plcb1	UTSW	2	135325802	critical splice donor site	probably null
R6683:Plcb1	UTSW	2	134786593	missense	probably benign	0.32
R6760:Plcb1	UTSW	2	135472060	missense	possibly damaging	0.50
R6947:Plcb1	UTSW	2	135386155	missense	probably benign	0.08
R6976:Plcb1	UTSW	2	135262239	missense	possibly damaging	0.75
R7379:Plcb1	UTSW	2	135370510	missense	probably benign	0.45
R7473:Plcb1	UTSW	2	135344276	missense	probably damaging	0.98
R7492:Plcb1	UTSW	2	135251764	nonsense	probably null
R7498:Plcb1	UTSW	2	135262233	nonsense	probably null
R7498:Plcb1	UTSW	2	135262234	missense	probably damaging	0.99
R7777:Plcb1	UTSW	2	135220757	missense	possibly damaging	0.51
R7924:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
R8061:Plcb1	UTSW	2	135346396	missense	probably benign
R8099:Plcb1	UTSW	2	135251734	missense	possibly damaging	0.68
R8299:Plcb1	UTSW	2	135335476	missense	probably damaging	1.00
R8394:Plcb1	UTSW	2	135317790	missense	probably damaging	1.00
R8439:Plcb1	UTSW	2	135250052	critical splice donor site	probably null
R8549:Plcb1	UTSW	2	135364933	missense	probably benign	0.00
R8693:Plcb1	UTSW	2	135252776	missense	probably benign	0.00
R8750:Plcb1	UTSW	2	135335449	missense	probably damaging	1.00
R8817:Plcb1	UTSW	2	135333509	intron	probably benign
R8950:Plcb1	UTSW	2	135337519	missense	probably damaging	1.00
R9146:Plcb1	UTSW	2	135340695	missense	probably damaging	1.00
R9301:Plcb1	UTSW	2	135325690	missense	possibly damaging	0.96
R9311:Plcb1	UTSW	2	135347465	missense	probably benign	0.00
R9459:Plcb1	UTSW	2	135322638	missense	probably benign	0.03
S24628:Plcb1	UTSW	2	135337499	missense	probably damaging	1.00
X0025:Plcb1	UTSW	2	135345054	missense	possibly damaging	0.87
Z1088:Plcb1	UTSW	2	135220846	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GTCCTGGAGATGAAACCCAG -3'
(R):5'- TTACATATCCCCAATCTGCAGC -3'

Sequencing Primer
(F):5'- AGATGGCCAAGTGCTCTTC -3'
(R):5'- CGTTTCAGTCATGGTAAACACCAGG -3'

Posted On

2014-08-25